United States
Germany
Japan
United Kingdom
China
Hacd2 (NM_023587) Mouse Untagged Clone
CAT＃: MC204564
Ptplb (untagged) - Mouse protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b (Ptplb), (10ug)
CNY 2,400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 6330408J20Rik; AI255777; AI481689; Hcad2; Ptplb |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC027289
GCAGGCGCGAGGGGAGCGGGGTTGCGGGCGCTTGACATGGCGGCAGCGGCGGCGACTGCAGCGACCAAGG GGAATGGGGGCGGCAGTGGCCGAGTCGGGGCTGGCGACAGCAGCGGCGCGCGGAAGAAGAAGGGCCCCGG GCCTGTGGCCACGGCGTACCTGGTCATCTACAATGTGGTGATGACGGCGGGGTGGCTGGTGATAGCAGTT GGGCTGGTGAGAGCATACCTGGCTAAGGGGAGCTACCATAGCCTTTATTATTCAATAGAAAGGCCTTTGA AGTTCTTCCAGACAGGAGCCTTACTGGAGATTTTACATTGTGCTATAGGGATTGTGCCATCTTCTGTTGT CCTGACTTCTTTCCAGGTGATGTCAAGAGTTTTCCTAATATGGGCAGTGACACATAGTGTCAAAGAGGTG CAGAGTGAAGACAGTGTACTTCTGTTTGTCATTGCCTGGACAATCACGGAAATTATCCGTTACTCCTTTT ACACATTCAGTCTATTAAACCATCTGCCTTATATCATCAAATGGGCCAGGTACACACTTTTCATCGTGCT GTACCCAATGGGAGTGACAGGAGAGCTCCTCACAATATACGCAGCTCTGCCCTTTGTCCGGCAGGCCGGC CTGTACTCCATCAGCTTACCTAACAAATACAACTTCTCCTTTGATTACCATGCATTCCTGATTCTGATCA TGATCTCCTACATTCCACTGTTCCCCCAGTTGTACTTCCACATGATACACCAGAGAAGAAAGGTCCTTTC TCACACCGAAGAACATAAGAAGTTTGAGTAGCGCTCCACACCACCCCAAACCAGACTTTTCAATGATCAA AATATGCTGCAGACTTTTTGAGTTCCCAGTAAGAACTATTTTTAAAATATTAAATATAAAACAAAATAAA AAACCAAAATCCAGTGTCACACAGGCCTGGGATTTTATAAAAAATAAAAATAAAAAGATTAAAAAAAAAA AAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_023587 |
| Insert Size | 765 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC027289, AAH27289 |
| RefSeq Size | 985 bp |
| RefSeq ORF | 765 bp |
| Locus ID | 70757 |
| UniProt ID | Q9D3B1 |
| Gene Summary | Catalyzes the third of the four reactions of the long-chain fatty acids elongation cycle. This endoplasmic reticulum-bound enzymatic process, allows the addition of two carbons to the chain of long- and very long-chain fatty acids/VLCFAs per cycle. This enzyme catalyzes the dehydration of the 3-hydroxyacyl-CoA intermediate into trans-2,3-enoyl-CoA, within each cycle of fatty acid elongation. Thereby, it participates in the production of VLCFAs of different chain lengths that are involved in multiple biological processes as precursors of membrane lipids and lipid mediators.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG203263 | Ptplb (tGFP-tagged) - Mouse protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b (Ptplb) |
CNY 2,850.00 |
|
| MR203263 | Ptplb (Myc-DDK-tagged) - Mouse protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b (Ptplb) |
CNY 2,400.00 |
|
| MR203263L3 | Lenti ORF clone of Ptplb (Myc-DDK-tagged) - Mouse protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b (Ptplb) |
CNY 4,750.00 |
|
| MR203263L4 | Lenti ORF clone of Ptplb (mGFP-tagged) - Mouse protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b (Ptplb) |
CNY 4,750.00 |
