Denr (NM_026603) Mouse Untagged Clone
CAT#: MC204458
Denr (untagged) - Mouse density-regulated protein (Denr), (10ug)
CNY 2,400.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1500003K04Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC043922
GTTGCATGTGTCGCTTCAGCTGGCGGGAGCGGAGGCGGCGGGGGCCGTGCGACCGGCTGGGTTTGTGAGA TGGCTACTGACATTTCTGAATCCAGCGGGGCGGATTGCAAAGGCGATACGAAGAACAGTGCCAAGTTAGA TGCGGATTACCCTCTTCGAGTCCTTTATTGTGGAGTCTGTTCATTACCAACAGAGTACTGTGAATACATG CCGGATGTTGCTAAATGTAGACAATGGCTAGAGAAGAACTTTCCAAATGAATTTGCAAAACTTACTGTAG AAAATTCACCCAAACAAGAAACTGGAATTACTGAAGGCCAAGGACCAGTAGGGGAAGAGGAGGAGAAGAA AAAACAAAAAAGAGGTGGAAGAGGTCAAATAAAACAGAAGAAGAAGACAGTACCACAGAAGGTCACGATA GCCAAAATTCCCAGAGCAAAGAAGAAATACGTGACGAGAGTGTGTGGCCTTGCAACTTTTGAAATTGATC TCAAAGAAGCACAAAGATTTTTTGCTCAAAAATTCTCGTGCGGTGCCTCAGTGACAGGGGAGGACGAGAT CATCATTCAGGGAGACTTCACAGATGACATCATTGACGTCATTCAGGAAAAGTGGCCAGAGGTGGATGAC GACAGCATTGAAGACCTTGGAGAAGTGAAGAAGTGATCCTGAAGTCATGTGTTTCTAACTGTGACCTGAG AGCTGACACGGCCAGCAGAGGAGAGGCCTTTCAGAATATATACATATGTACATTTGTGTGTATATATACC CTACAGTAAAGCTGTCGACTCCTCGTCCTCGGCGTCCTCACTGTTCCGTAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_026603 |
Insert Size | 597 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC043922, AAH43922 |
RefSeq Size | 874 bp |
RefSeq ORF | 597 bp |
Locus ID | 68184 |
UniProt ID | Q9CQJ6 |
Gene Summary | May be involved in the translation of target mRNAs by scanning and recognition of the initiation codon. Involved in translation initiation; promotes recruitment of aminoacetyled initiator tRNA to P site of 40S ribosomes. Can promote release of deacylated tRNA and mRNA from recycled 40S subunits following ABCE1-mediated dissociation of post-termination ribosomal complexes into subunits (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201977 | Denr (tGFP-tagged) - Mouse density-regulated protein (Denr) |
CNY 2,850.00 |
|
MR201977 | Denr (Myc-DDK-tagged) - Mouse density-regulated protein (Denr) |
CNY 2,400.00 |
|
MR201977L3 | Lenti ORF clone of Denr (Myc-DDK-tagged) - Mouse density-regulated protein (Denr) |
CNY 4,750.00 |
|
MR201977L4 | Lenti ORF clone of Denr (mGFP-tagged) - Mouse density-regulated protein (Denr) |
CNY 4,750.00 |