Vamp8 (NM_016794) Mouse Untagged Clone

CAT#: MC204264

Vamp8 (untagged) - Mouse vesicle-associated membrane protein 8 (Vamp8), (10ug)



  "NM_016794" in other vectors (4)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Vamp8 Antibody - middle region
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms AU041171; Edb; endobrevin
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC012668
CCACGCGTCCGGGAGGCGGGCTGAAAGTTGGAGTAAGCAGGAAGTGAAGCTGTGGCTGCCTTGGGTGGAA ACAGACTAGGCGAAGTTCTGCTTTGAGAGGCCCAAGTGCTCCGAGACATGGAGGAGGCCAGTGGGAGTGC CGGAAATGACCGAGTTAGGAACCTGCAGAGTGAGGTGGAGGGAGTCAAGAATATTATGACCCAGAATGTG GAGCGGATCTTGGCCAGAGGGGAGAACCTGGACCACCTCCGAAACAAGACAGAGGACTTGGAAGCCACGT CTGAACACTTCAAGACAACGTCCCAGAAGGTGGCCCGGAAGTTCTGGTGGAAGAATGTGAAGATGATTGT CATCATCTGTGTGATTGTCCTTATCATCGTCATCCTCATTATACTTTTTGCCACTGGTACCATCCCCACT TAAGAGTCCCTTCCATCCCACCCTACTCCTCAGGGGTGACCTCCCTAATATGTGCCAAGAGGAGCCCTCT CCTGTCCTCCTCCACCCAAGTGCTGCTCAGTCCCTGTGAGGGCCTTCTGCTGCATCAGATGCCCCAGACG CACCTTGATCCCCTGGGAGGAGACAGCTGGACTGTAGCTGCATCTCATGGTCCTGAGAGTGGGTTACAGA GACCCAGAGGACCCTGTCTGTGGCTGGGAAACTGTTGGTGGCTGGTGGGCAATAAAGACCTCTTGGTATC CCTAAGTGTAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_016794
Insert Size 306 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC012668, AAH12668
RefSeq Size 730 bp
RefSeq ORF 306 bp
Locus ID 22320
UniProt ID O70404
Gene Summary SNAREs, soluble N-ethylmaleimide-sensitive factor-attachment protein receptors, are essential proteins for fusion of cellular membranes. SNAREs localized on opposing membranes assemble to form a trans-SNARE complex, an extended, parallel four alpha-helical bundle that drives membrane fusion. VAMP8 is a SNARE involved in autophagy through the direct control of autophagosome membrane fusion with the lysososome membrane via its interaction with the STX17-SNAP29 binary t-SNARE complex (By similarity). Also required for dense-granule secretion in platelets (By similarity). Plays also a role in regulated enzyme secretion in pancreatic acinar cells (PubMed:15363411). Involved in the abscission of the midbody during cell division, which leads to completely separate daughter cells (By similarity). Involved in the homotypic fusion of early and late endosomes (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...