Ift27 (NM_025931) Mouse Untagged Clone
CAT#: MC203941
Ift27 (untagged) - Mouse intraflagellar transport 27 homolog (Chlamydomonas) (Ift27), (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2600013G09Rik; Rabl4 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC017514
GAAGGCGGGTTGATGATGGTTGCCAGGAGCCTGTTTGGCGCGACTCTTGGGACCAGAGGACTAGTGGTTG TGTCTCAACTCTTCTTTGGGCCGGGTCTAAGGCTGGACTTGGAACGGGTTCTGCTCCGCCCCACCGGAAC CTTTGCAGGCTGCCTGGGGCCTGAAGCCCTCCGTCCACCCAACCCTAGCACCCGGGCCATCATCCATCCC TCCATCACGGCCTCAGGCCCTGGTGTCAGCTGTCCCCGAATCCTAACCCCCTTTCAGCGTCCCCCACCCC CACGTCTCCGCTAGTACCTGGTTACTATGGTGAAGCTAGCTGCCAAATGCATCCTGGCAGGGGACCCAGC CGTAGGCAAGACGGCCCTGGTGCAGATGTTCCGCAGCGACGGGACCCATTTCCAGAAGAACTACACCCTG ACAACTGGAGTGGATTTGGTGGTGAAGACAGTGCCAGTTCTTGACACAAATGACAGTGTGGAACTCTTCA TTTTTGACTCAGCCGGCAAGGAGCTGTTCTCTGAAATGCTGGATAAGTTGTGGGAGAATCCCAACGTCCT GTGCCTTGTCTATGATGTGACCAATGAACAGTCCTTCATCAGCTGCACCAAGTGGTTGGAGAAGGTCCGG TCTCAGACTTCAGGCATCTCCCTCCCAGGTGTTTTAGTGGGAACTAAGACAGACCTGGCTGGCCGACAAA CAGTGGATTCAGCTCAGGCCCAGGTATGGGCACTGAGTCAAGGCCTGGAATTCTTTGAGACATCTGTGAA GGAGATGGATAATTACGAGGCCCCGTTCCACTGTCTGGCCAAGCAGTTCTACCAGCTGTACCGGGAAAAA GTGGACATATTCCATACCCTGGTGTGAGGGTACAGTGGACTGTCCTGAAGGGCTGCCCACTCTGCCGCTG CTGCTGTGAGCCCAGCAGACCATTGTCTTTTCAGGAGACAGAAGACGGGATCACCTGGGATTTCTCAGTA TCCACCATGGTTTTCAATAAAATGAGAAGAGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025931 |
Insert Size | 561 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC017514, AAH17514 |
RefSeq Size | 1050 bp |
RefSeq ORF | 561 bp |
Locus ID | 67042 |
UniProt ID | Q9D0P8 |
Gene Summary | Small GTPase-like component of the intraflagellar transport (IFT) complex B that promotes the exit of the BBSome complex from cilia via its interaction with ARL6 (PubMed:25446516). Not involved in entry of the BBSome complex into cilium. Prevents aggregation of GTP-free ARL6. Required for hedgehog signaling (PubMed:25446516). Forms a subcomplex within the IFT complex B with IFT25 (By similarity). Its role in intraflagellar transport is mainly seen in tissues rich in ciliated cells such as kidney and testis. Essential for male fertility, spermiogenesis and sperm flagella formation (PubMed:28964737). Plays a role in the early development of the kidney (PubMed:29626631). May be involved in the regulation of ureteric bud initiation (PubMed:29626631).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201739 | Ift27 (tGFP-tagged) - Mouse RAB, member of RAS oncogene family-like 4 (Rabl4) |
CNY 2,850.00 |
|
MR201739 | Ift27 (Myc-DDK-tagged) - Mouse intraflagellar transport 27 homolog (Chlamydomonas) (Ift27) |
CNY 2,400.00 |
|
MR201739L3 | Lenti ORF clone of Ift27 (Myc-DDK-tagged) - Mouse intraflagellar transport 27 homolog (Chlamydomonas) (Ift27) |
CNY 4,750.00 |
|
MR201739L4 | Lenti ORF clone of Ift27 (mGFP-tagged) - Mouse intraflagellar transport 27 homolog (Chlamydomonas) (Ift27) |
CNY 4,800.00 |