Vps28 (NM_025842) Mouse Untagged Clone
CAT#: MC203838
Vps28 (untagged) - Mouse vacuolar protein sorting 28 (yeast) (Vps28), (10ug)
CNY 2,400.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1110014J03Rik; CIIA; D730005C08Rik |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC013535
AGCGAGCACCGAGCTTCTGTCGCCATCTCCGGGACTCCAAACGCCCCAGGTCTCTTGTGCTGTATAGCTG CCTGGGCCTGCAGGATGTTCCACGGGATCCCGGCTACTCCTGGTGTTGGAGCCCCTGGGAACAAGCCGGA GCTGTATGAGGAAGTAAAGCTCTACAAGAATGCTCGGGAGCGGGAGAAGTATGACAACATGGCAGAGCTC TTTGCCGTGGTGAAGACGATGCAGGCCCTGGAGAAGGCGTACATCAAGGACTGTGTCACCCCCAATGAGT ACACTGCAGCCTGCTCCAGGCTCCTGGTCCAGTACAAAGCTGCCTTCCGACAGGTCCAAGGCTCAGAGAT CAGCTCCATTGATGAATTTTGCCGAAAGTTCAGACTGGACTGCCCACTTGCTATGGAGAGGATCAAAGAG GACCGGCCCATCACTATCAAAGACGACAAGGGCAATCTCAACCGCTGCATTGCAGATGTTGTTTCGCTCT TCATTACAGTCATGGACAAGCTGCGTCTGGAGATCCGTGCCATGGACGAGATTCAGCCAGACCTGCGGGA GCTGATGGAGACAATGCACAGAATGAGCCACCTGCCTCCAGACTTCGAGGGCCGCCAGACAGTCAGCCAG TGGCTGCAGACCCTGAGTGGTATGTCGGCCTCTGACGAGCTGGATGACTCTCAAGTTCGCCAGATGCTCT TCGATCTGGAGTCCGCTTACAACGCCTTTAACCGCTTCCTACACGCCTAAGCCTCACAGAGACAGGAATG AGAGTGGTAGAGATGTGACGACTCAGCCCCCCAGTGTGTCTACATCCGTCCTAGATGCCTATATTGTCAG GATATCACCCACAATAAATATTTGTCTAACCTTCAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025842 |
Insert Size | 666 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC013535, AAH13535 |
RefSeq Size | 889 bp |
RefSeq ORF | 666 bp |
Locus ID | 66914 |
UniProt ID | Q9D1C8 |
Gene Summary | This gene encodes a protein which is thought to be a subunit of the ESCRT-I complex (endosomal complexes required for transport), which functions in the transport and sorting of proteins into subcellular vesicles. This complex can also be hijacked to facilitate the budding of enveloped viruses from the cell membrane. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2015] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202545 | Vps28 (tGFP-tagged) - Mouse vacuolar protein sorting 28 (yeast) (Vps28) |
CNY 4,000.00 |
|
MR202545 | Vps28 (Myc-DDK-tagged) - Mouse vacuolar protein sorting 28 (yeast) (Vps28) |
CNY 2,400.00 |
|
MR202545L3 | Lenti ORF clone of Vps28 (Myc-DDK-tagged) - Mouse vacuolar protein sorting 28 (yeast) (Vps28) |
CNY 4,750.00 |
|
MR202545L4 | Lenti ORF clone of Vps28 (mGFP-tagged) - Mouse vacuolar protein sorting 28 (yeast) (Vps28) |
CNY 4,750.00 |