Sub1 (NM_011294) Mouse Untagged Clone
CAT#: MC203765
Sub1 (untagged) - Mouse SUB1 homolog (S. cerevisiae) (Sub1), (10ug)
CNY 1,200.00
CNY 2,000.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AI842364; P9; P15; Pc4; Rpo2tc1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC010967
CCACGCGTCCGGGCGAGCGAGCGAGGCAGAGGTTTTTGGTCGGCCGGAGCGTAGCAATGCCTAAATCAAA GGAACTTGTTTCTTCAAGCTCTTCAGGCAGTGATTCGGACAGCGAAGTTGAAAAAAAGTTAAAGAGGAAA AAGCAAGCGGTTCCAGAGAAGCCCGTGAAGAAGCAGAAGCCTGGTGAGACTTCTAGAGCACTGGCATCCT CCAAGCAGAGCAGCAGCAGCAGAGATGACAACATGTTCCAGATTGGAAAGATGAGATATGTCAGTGTTCG GGACTTCAAAGGAAAAATTCTAATTGATATTAGAGAATATTGGATGGATTCAGAAGGTGAAATGAAACCA GGAAGAAAAGGTATTTCTTTAAACATGGAACAATGGAGCCAGCTGAAGGAACAGATCTCTGATATAGATG ACGCAGTAAGAAAGCTGTAAAATCTGAGCCATATCAAACCTGTACTGTTGTAGTTGTCTTTTTACATTGG CTTTTGTTTTCTAAATGTTGTTTTCCAAGCTGTTGTATATTTGGATTGCAGAACAATTTGTAAGACAAAT ACTTTTTTTTAATGTGCATTATTAAAATGTTCTAAGTGAAGCTAATTGTCAAGTTTATTAAAGGATTGCT TTGTGCCCCCTACCTAGTGTAAAATAAAGTCAGATCATTACAATCTTAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_011294 |
Insert Size | 384 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC010967, AAH10967 |
RefSeq Size | 694 bp |
RefSeq ORF | 384 bp |
Locus ID | 20024 |
UniProt ID | P11031 |
Gene Summary | General coactivator that functions cooperatively with TAFs and mediates functional interactions between upstream activators and the general transcriptional machinery. May be involved in stabilizing the multiprotein transcription complex. Binds single-stranded DNA. Also binds, in vitro, non-specifically to double-stranded DNA (ds DNA).[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
An integrated systems biology approach identifies positive cofactor 4 as a factor that increases reprogramming efficiency
,Jo, J;Hwang, S;Kim, HJ;Hong, S;Lee, JE;Lee, SG;Baek, A;Han, H;Lee, JI;Lee, I;Lee, DR;,
Nucleic Acids Res.
,PubMed ID 26740582
[SUB1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MR200688 | Sub1 (Myc-DDK-tagged) - Mouse SUB1 homolog (S. cerevisiae) (Sub1) |
CNY 1,200.00 |
|
MR200688L3 | Lenti ORF clone of Sub1 (Myc-DDK-tagged) - Mouse SUB1 homolog (S. cerevisiae) (Sub1) |
CNY 4,750.00 |
|
MR200688L4 | Lenti ORF clone of Sub1 (mGFP-tagged) - Mouse SUB1 homolog (S. cerevisiae) (Sub1) |
CNY 4,750.00 |