Hspb1 (NM_013560) Mouse Untagged Clone
CAT#: MC203704
Hspb1 (untagged) - Mouse heat shock protein 1 (Hspb1), (10ug)
CNY 2,000.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 27kDa; Hsp25 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC018257
GCACGCTGGGGCTCCAGTCCGGCACTTCTCGGATCCTCAGCCCAGTGCTTCTAGATCCTCAGCCTTGACC AGCCAAGAACATGACCGAGCGCCGCGTGCCCTTCTCGCTGCTGCGGAGCCCGAGCTGGGAACCATTCCGG GACTGGTACCCTGCACACAGCCGCCTCTTCGATCAAGCTTTCGGGGTGCCCCGGTTGCCCGATGAGTGGT CGCAGTGGTTCAGCGCCGCTGGGTGGCCCGGATACGTGCGCCCGCTGCCCGCCGCGACCGCCGAGGGCCC CGCGGCGGTGACCCTGGCCGCACCAGCCTTCAGCCGAGCGCTCAACCGACAGCTCAGCAGCGGGGTCTCG GAGATCCGACAGACGGCTGATCGCTGGCGCGTGTCCCTGGACGTCAACCACTTCGCTCCGGAGGAGCTCA CAGTGAAGACCAAGGAAGGCGTGGTGGAGATCACTGGCAAGCACGAAGAAAGGCAGGACGAACATGGCTA CATCTCTCGGTGCTTCACCCGGAAATACACGCTCCCTCCAGGTGTGGACCCCACCCTAGTGTCCTCTTCC CTATCCCCTGAGGGCACACTTACCGTGGAGGCTCCGTTGCCCAAAGCAGTCACGCAGTCAGCGGAGATCA CCATTCCGGTTACTTTCGAGGCCCGCGCCCAAATTGGGGGCCCAGAAGCTGGGAAGTCTGAACAGTCTGG AGCCAAGTAGAAGCCATCAGCCTGCTGCCTATCTCCCATAGCCATTGCTGGCCACCCCTCTCTGTCAATC TGTGCGCTCTTTTGATACATACATTTACCTGCTGTTTTTCTCAAATAAAAGTTGCAAGCTACTGCTCACC ACAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_013560 |
Insert Size | 630 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC018257, AAH18257 |
RefSeq Size | 862 bp |
RefSeq ORF | 630 bp |
Locus ID | 15507 |
UniProt ID | P14602 |
Gene Summary | Small heat shock protein which functions as a molecular chaperone probably maintaining denatured proteins in a folding-competent state. Plays a role in stress resistance and actin organization (PubMed:17661394). Through its molecular chaperone activity may regulate numerous biological processes including the phosphorylation and the axonal transport of neurofilament proteins (By similarity).[UniProtKB/Swiss-Prot Function] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Silencing Heat Shock Protein 27 Inhibits the Progression and Metastasis of Colorectal Cancer (CRC) by Maintaining the Stability of Stromal Interaction Molecule 1 (STIM1) Proteins
,Huang, CY;Wei, PL;Chen, WY;Chang, WC;Chang, YJ;,
Cells
,PubMed ID 30544747
[HSPB1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202214 | Hspb1 (tGFP-tagged) - Mouse heat shock protein 1 (Hspb1) |
CNY 2,850.00 |
|
MR202214 | Hspb1 (Myc-DDK-tagged) - Mouse heat shock protein 1 (Hspb1) |
CNY 2,081.00 |
|
MR202214L3 | Lenti ORF clone of Hspb1 (Myc-DDK-tagged) - Mouse heat shock protein 1 (Hspb1) |
CNY 4,750.00 |
|
MR202214L4 | Lenti ORF clone of Hspb1 (mGFP-tagged) - Mouse heat shock protein 1 (Hspb1) |
CNY 4,750.00 |