Ntmt1 (NM_170592) Mouse Untagged Clone

CAT#: MC202863

Ntmt1 (untagged) - Mouse methyltransferase like 11A (Mettl11a), (10ug)



  "NM_170592" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
NTMT1 Antibody - N-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2610205E22Rik; AL033331; AL033332; Mettl11a; NTM1A
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027220 sequence for NM_170592
GAGGTGTCTGGTCCGGTAGAGTGGTGGCGGCTGCTGTGGGCTACGGTCTTTGCCAGCCTCCTTCTCAACC CGTCCTTTTCTCTCGGGTCCCTGGAGCCCCGACCCAGGGGAGCAGCGAGGTGGCTGGCGACTTCACGGCT GGTGACGTCATGACGAGCGAGGTGATTGAGGATGAGAAACAGTTTTATTCGAAGGCCAAGACCTACTGGA AGCAGATCCCACCCACGGTGGACGGCATGCTCGGGGGGTATGGCCACATCTCCAACATCGACCTCAACAG CTCCCGGAAGTTTCTACAGAGGTTTTTAAGGGAAGGCCCAAACAAGACAGGGACTTCCTGTGCCTTGGAC TGTGGCGCTGGTATTGGAAGGATCACCAAGCGCCTGCTCCTGCCACTCTTCAGGGTGGTCGACATGGTCG ACGTGACAGAAGACTTTCTGGCCAAAGCCAAGACCTACCTGGGGGAAGAGGGCAAGAGGGTGAGGAACTA CTTCTGCTGTGGGCTGCAGGACTTCAGCCCTGAGCCTGGCTCCTATGACGTGATCTGGATCCAGTGGGTG ATAGGCCACCTGACGGATCAGCACCTGGCTGAGTTTCTGCGCCGCTGCAAGCGGGGCCTGCGCCCCAATG GCATCATCGTCATCAAGGACAACATGGCCCAGGAGGGTGTGATCCTGGACGATGTGGACAGCAGTGTGTG CCGGGACCTTGAGGTGGTCCGCCGGATCATCCGCACTGCAGGCCTCAGCCTCCTGGCCGAGGAGCGCCAG GAGAACCTGCCAGATGAGATCTACCATGTCTACAGCTTTGCCCTGAGATGAAGCCAGGGCCAGAGCTGGG GGCCAGCAGCTGGCAGGCCAAGAGACACACCATTGACTCCAGTGGGAAGGGTCAAGCCCTAGGGGAGGTG TGCCCTGGATTGGGGCACTGCAGCCCTGTCACTCTAAAGCACCCTGGCAGCTTCCCACAGGGCTATGGAA AGCAGAGTTGGTCACCGCTGGTCTAGCTGCCCAAGGAGAAAGACTTCACTTGGTTGCCTAGGGACCTCAA TGTGTGGACTGCTGTGTTCCAGGACAGCCAGGCCACACATGGTACCTGCCAGACAGTACCAATTACAGAA ATGGTCACAGCCCCATATCCTCTTTGGTGATGGGTCACAGCAGCCTGCAGCTCCTAGGAGCTCCTCTCTG ACACAGCCAATAAAAGGGTGAGTCCTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_170592
Insert Size 672 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC027220, AAH27220
RefSeq Size 1251 bp
RefSeq ORF 672 bp
Locus ID 66617
UniProt ID Q8R2U4
Gene Summary Distributive alpha-N-methyltransferase that methylates the N-terminus of target proteins containing the N-terminal motif [Ala/Gly/Pro/Ser]-Pro-Lys when the initiator Met is cleaved. Specifically catalyzes mono-, di- or tri-methylation of the exposed alpha-amino group of the Ala, Gly or Ser residue in the [Ala/Gly/Ser]-Pro-Lys motif and mono- or di-methylation of Pro in the Pro-Pro-Lys motif (PubMed:20668449). Some of the substrates may be primed by METTL11B-mediated monomethylation. Catalyzes the trimethylation of the N-terminal Gly in CENPA (after removal of Met-1) (By similarity). Responsible for the N-terminal methylation of KLHL31, MYL2, MYL3, RB1, RCC1, RPL23A and SET. Required during mitosis for normal bipolar spindle formation and chromosome segregation via its action on RCC1 (PubMed:20668449).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the longest isoform (a). Variants 1 and 2 both encode the same isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...