Gabarapl2 (NM_026693) Mouse Untagged Clone

CAT#: MC202843

Gabarapl2 (untagged) - Mouse gamma-aminobutyric acid (GABA) A receptor-associated protein-like 2 (Gabarapl2), (10ug)



  "NM_026693" in other vectors (5)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 0610012F20Rik; 2900019O08Rik; AI173605; GATE-16; Gef2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC026798 sequence for NM_026693
CCCGCCTCCGTTGTTGTTGTGGTCGCTTCGCCGAAGTCCGCGGCTCGAAGAGCCGGCTCCGTCGCTTCCC GTCGCCATGAAGTGGATGTTTAAGGAGGACCACTCTCTGGAACACAGATGCGTGGAATCCGCGAAGATCA GAGCGAAGTACCCCGACCGAGTTCCGGTGATCGTGGAAAAAGTCTCGGGCTCTCAGATTGTTGACATAGA CAAGAGGAAGTACTTGGTCCCCTCGGACATCACTGTGGCTCAGTTCATGTGGATCATCAGGAAAAGGATC CAGCTTCCCTCCGAGAAGGCCATCTTCCTGTTTGTGGACAAGACAGTCCCACAGTCCAGCCTAACTATGG GACAGCTTTACGAGAAGGAAAAAGATGAAGATGGATTCTTGTATGTGGCCTACAGCGGAGAGAACACTTT TGGCTTCTGAGGCCCTTGCTGGGCTAGGTGCGCCCTTCCTGCTTGTGTCTCTTGTAAATAACTGGCTGTT CTCAGTTACTCTGCCAGAGCCTCCACACAGACCTACTAGTGCATTTGTAACTGGATTTATTTCTTAATAT ATTGGAAGGTTTTGTTTCCTTAGATTAGTAAATTATCATACAGAGTTTTATTTTCAGTTTTCTTTTTGTG CACTGTCCTCATGGCTATTTGCTCCAGGGAACCTGTCCTCTGGGAATCATATTTAATGAAGATATTTCCG TAATGAAGGGAGGTAGGTGTGGTGGTAAAGGGAAAAGGAGGGGCTGATGCATAGTTCTGGATTATGTTGA AAGTGTTAGATGGCTAAGTATTAAAAGCACCCAGATTAAATCCTTAGCAATCAGAACACTTGCTTCACTA GATTTTGCCAACTGCAAATCATGTTGGACTGAGCTAATCTATTCTTCTTTCTGAGACTATTAAGGTAAAT AATTAACAATAAAGCCTCCTTATAAAGGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_026693
Insert Size 354 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC026798, AAH26798
RefSeq Size 976 bp
RefSeq ORF 354 bp
Locus ID 93739
UniProt ID P60521
Gene Summary Ubiquitin-like modifier involved in intra-Golgi traffic. Modulates intra-Golgi transport through coupling between NSF activity and SNAREs activation. It first stimulates the ATPase activity of NSF which in turn stimulates the association with GOSR1 (By similarity). Involved in autophagy. Plays a role in mitophagy which contributes to regulate mitochondrial quantity and quality by eliminating the mitochondria to a basal level to fulfill cellular energy requirements and preventing excess ROS production. Whereas LC3s are involved in elongation of the phagophore membrane, the GABARAP/GATE-16 subfamily is essential for a later stage in autophagosome maturation.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...