Rpl13a (NM_009438) Mouse Untagged Clone
CAT#: MC202752
Rpl13a (untagged) - Mouse ribosomal protein L13A (Rpl13a), (10ug)
CN¥ 2,400.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1810026N22Rik; Tstap198-7; tum-antigen |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC082289 sequence for NM_009438
GCCGAAGATGGCGGAGGGGCAGGTTCTGGTATTGGATGGCCGAGGCCATCTTCTTGGCCGCCTGGCGGCC ATTGTGGCCAAGCAGGTACTTCTGGGCCGGAAGGTGGTGGTCGTACGCTGTGAAGGCATCAACATTTCTG GAAACTTCTACAGAAACAAGTTAAAGTATCTGGCCTTTCTCCGGAAGCGGATGAATACCAACCCCTCCCG AGGCCCCTACCACTTCCGAGCCCCCAGCCGCATTTTCTGGCGCACTGTGCGAGGCATGCTGCCCCACAAG ACCAAGAGAGGCCAGGCTGCCCTGGAGCGCCTCAAGGTGTTGGATGGGATCCCTCCACCCTATGACAAGA AAAAGCGGATGGTGGTCCCTGCTGCTCTCAAGGTTGTTCGGCTGAAGCCTACCAGAAAGTTTGCTTACCT GGGGCGTCTGGCGCATGAGGTCGGGTGGAAGTACCAGGCAGTGACAGCCACTCTGGAGGAGAAACGGAAG GAAAAGGCCAAGATGCACTATCGGAAGAAGAAGCAGATCTTGAGGTTACGGAAACAGGCAGAAAAGAATG TGGAGAAGAAAATCTGCAAGTTCACAGAGGTCCTCAAGACCAACGGACTCCTGGTGTGAACCCAATAAAG ACTGTTTGCCTCAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_009438 |
Insert Size | 612 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC082289, AAH82289 |
RefSeq Size | 658 bp |
RefSeq ORF | 612 bp |
Locus ID | 22121 |
UniProt ID | P19253 |
Gene Summary | Associated with ribosomes but is not required for canonical ribosome function and has extra-ribosomal functions (By similarity). Component of the GAIT (gamma interferon-activated inhibitor of translation) complex which mediates interferon-gamma-induced transcript-selective translation inhibition in inflammation processes. Upon interferon-gamma activation and subsequent phosphorylation dissociates from the ribosome and assembles into the GAIT complex which binds to stem loop-containing GAIT elements in the 3' UTR of diverse inflammatory mRNAs (such as ceruplasmin) and suppresses their translation. In the GAIT complex interacts with m7G cap-bound eIF4G at or near the eIF3-binding site and blocks the recruitment of the 43S ribosomal complex.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202103 | Rpl13a (tGFP-tagged) - Mouse ribosomal protein L13a (Rpl13a) |
CN¥ 2,850.00 |
|
MR202103 | Rpl13a (Myc-DDK-tagged) - Mouse ribosomal protein L13A (Rpl13a) |
CN¥ 2,400.00 |
|
MR202103L3 | Lenti ORF clone of Rpl13a (Myc-DDK-tagged) - Mouse ribosomal protein L13A (Rpl13a) |
CN¥ 4,750.00 |
|
MR202103L4 | Lenti ORF clone of Rpl13a (mGFP-tagged) - Mouse ribosomal protein L13A (Rpl13a) |
CN¥ 4,750.00 |