United States
Germany
Japan
United Kingdom
China
Cryba4 (NM_021351) Mouse Untagged Clone
CAT＃: MC202680
Cryba4 (untagged) - Mouse crystallin, beta A4 (Cryba4), (10ug)
CNY 2,400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC058703 sequence for NM_021351
GGCCCTTCTTGGACCGTGCCAACATGACCCTGCAGTGCACCAAGTCAGCTGGACACTGGAGGATGGTGGT GTGGGATGAAGAAGGCTTCCAGGGCCGACGGCATGAATTCACAGCTGAGTGTCCCAGTGTCCTGGAACTT GGTTTTGAGACGGTGCGATCTCTCAAAGTCCTGAGCGGAGCGTGGGTAGGCTTTGAGCACGCCGGCTTCC AAGGACAGCAATATGTGCTGGAGAGGGGCGATTACCCGGGCTGGGATGCCTGGGGTGGCAACACAGCCTA CCCTGCGGAGAGGCTCACCTCCTTCCGGCCTGTGGCCTGCGCTAACCACCGCGACTCAAGGCTGACCATC TTCGAGCAGGAGAACTTCCTGGGCAGGAAAGGCGAGCTGAACGATGACTATCCCTCTCTGCAGGCCATGG GCTGGGACGGCACTGAAGTGGGCTCCTTCCATGTTCAATCTGGGGCGTGGGTTTGTTCCCAGTTTCCTGG CTACCGAGGTTTTCAGTACATCCTGGAGAGCGATCACCACTCAGGTGACTACAAGCACTTCAGAGAGTGG GGCTCCCATGCTCACACCTTCCAGGTGCAGAGTGTGCGCAGAATCCAGCAGTGAGCACGCACTGGCGACC TGGGGTGCCTGCGAAACGACTGGGTGACTGGCCGGAGGATGTGGCTGCTCTTGGTTCTGGCTACCCTTGT GTCCTCTGGGAACCCCACATCCCTGTCAGCCAGCCCATGCCCCGCCAGCTCATGGAGCTCAAAGAAATAA AATGAAAAACAAAAGACTCAGAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | AscI-NotI |
| ACCN | NM_021351 |
| Insert Size | 591 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC058703, AAH58703 |
| RefSeq Size | 814 bp |
| RefSeq ORF | 591 bp |
| Locus ID | 12959 |
| UniProt ID | Q9JJV0 |
| Gene Summary | This gene encodes a member of the crystallin family of proteins that contribute to the transparency and refractive properties of the ocular lens. Certain mutations in the human ortholog of this gene are associated with cataract and bilateral microphthalmia. This gene is located adjacent to a related crystallin gene on chromosome 5. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer protein (isoform 1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG201946 | Cryba4 (tGFP-tagged) - Mouse crystallin, beta A4 (Cryba4) |
CNY 2,850.00 |
|
| MR201946 | Cryba4 (Myc-DDK-tagged) - Mouse crystallin, beta A4 (Cryba4) |
CNY 2,400.00 |
|
| MR201946L3 | Lenti ORF clone of Cryba4 (Myc-DDK-tagged) - Mouse crystallin, beta A4 (Cryba4) |
CNY 4,750.00 |
|
| MR201946L4 | Lenti ORF clone of Cryba4 (mGFP-tagged) - Mouse crystallin, beta A4 (Cryba4) |
CNY 4,750.00 |
