1810009A15Rik (NM_025463) Mouse Untagged Clone
CAT#: MC202324
1810009A15Rik (untagged) - Mouse RIKEN cDNA 1810009A15 gene (1810009A15Rik), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC047099 sequence for NM_025463
GAATGAGCCGCGGAGTGTAGCCATGGCACCTCCGGGAGGAAAGATCAATCGTCCCCGGACGGAGCTGAAG AAGAAGTTGTTCAAGCGCCGCAGGGTATTAAGCAGGGATCGGCGACGGAAACGCCAGGTGGTCGGGGCTG TGATAGACGAAGGGCTGACTACGAAGCACCACCTCAAGAAGCGGGCGTCCAGTGCTCGTGCCAACATCAC GCTGTCTGGGAAGAAGCGCAGGAAACTCTTGCAGCAGATCCGACTTGCCCAGAAAGAAAAAGCAGCCATG GAAGTGGAAGCCCCCTCCAAGTCAACCAGGACTAGTCAGCCACAGCCCAAGCAACAAAAGAAGATAAAAG CTCCCCAGGACGTAGCTATGGAGGATCTTGAAGATAAGAGCTAAAATCCCTGCCTCTTCTACCAGAAGAT GGTCAACAGCACTGAGAAAGATTTGGAGGAACTTTGGAAAAAATATTAGCATATTTCACTTTCCTAGACA CCTCTTCTACAGCGGACCCTGACCTCCCCTGGAGGTGTATATTGGGACCGAAGAGGACACAGAGAAAGAC TGGAGGGCCACCTCTAGCAGTCAACTCCTTTTGTAATAAAGCTTTAGTGCGTTCAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_025463 |
Insert Size | 372 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC047099, AAH47099 |
RefSeq Size | 629 bp |
RefSeq ORF | 372 bp |
Locus ID | 66276 |
UniProt ID | Q9D937 |
Gene Summary | This gene shares three exons in common with another gene, LBH domain containing 1 (GeneID:102308570), but the encoded protein uses a reading frame that is different from that of the LBH domain containing 1 gene. [provided by RefSeq, Nov 2017] Transcript Variant: This variant (1) represents the protein-coding transcript. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200627 | 1810009A15Rik (tGFP-tagged) - Mouse RIKEN cDNA 1810009A15 gene (1810009A15Rik) |
CNY 2,850.00 |
|
MR200627 | 1810009A15Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1810009A15 gene (1810009A15Rik) |
CNY 1,200.00 |
|
MR200627L3 | Lenti ORF clone of 1810009A15Rik (Myc-DDK-tagged) - Mouse RIKEN cDNA 1810009A15 gene (1810009A15Rik) |
CNY 4,750.00 |
|
MR200627L4 | Lenti ORF clone of 1810009A15Rik (mGFP-tagged) - Mouse RIKEN cDNA 1810009A15 gene (1810009A15Rik) |
CNY 4,750.00 |
其它1810009A15Rik产品