Pqbp1 (NM_019478) Mouse Untagged Clone

CAT#: MC202028

Pqbp1 (untagged) - Mouse polyglutamine binding protein 1 (Pqbp1), (10ug)



  "NM_019478" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Pqbp1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms npw38; PQBP-1; Sfc2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC051673 sequence for NM_019478
AGAGCCTGTTGTGCTTTAAACCAAGAGCCCTTCGGTGTTGGTCTGGTCAGCTACCCACTATGCCGCTTCC TGTTGCGCTGCAGACCCGCTTGGCGAAGAGGAGCATCCTCAAACATCTGGAGCCGGAGCCAGAGGAAGAG ATTATTGCTGAAGACTACGATGATGATCCTGTTGACTATGAGGCCACCCGGATAGAGGGTCTGCCACCGA GCTGGTACAAGGTGTTTGACCCTTCTTGCGGACTCCCTTACTATTGGAATGTGGAGACAGACCTTGTGTC GTGGCTCTCACCACATGATCCTAACTTTGTCGTTACCAAATCCGCCAAGAAAGTCAGGAACAATAATGCA GATGCTGAGGACAAGTCGGACCGGAATCTTGAAAAGGTGGACAGAAATCATGAGAAGTCAGATCGTAGTC ATGAGAAGCCAGACAGGAGCCACGAGAAGGCAGACCGAAACCACGAGAAGAATGACAGAGAACGAGAGCG CAACTACGACAAAGTGGATAGAGAGAGAGATCGGGACAGGGAACGAGAGCGGGCATTTGACAAGGCAGAC CGGGAAGAGGGCAAAGACCGACGTCACCATCGCAGAGAGGAACTGGCTCCTTACCCCAAGAACAAGAAAG CGACGAGCCGCAAAGATGAAGAATTAGACCCCATGGACCCCAGCTCATACTCAGATGCACCCCGGGGCAC ATGGTCAACAGGACTCCCCAAGAGGAACGAGGCCAAGACAGGTGCTGACACCACGGCAGCTGGGCCCCTC TTCCAGCAGCGCCCTTACCCTTCCCCGGGCGCTGTGCTCCGCGCCAATGCAGAAGCCTCCCGAACCAAAC AGCAGGACTGACTGACCCCTTGTTCCCTGTAGCTTTGGCAGTTTGCGTTTCTGTGTTTCTTCCTTGTGGC TCTGGGACAGGAGCCATGGCTTCTATGTGCTGCATTATTATTCCACCAGTGAGCTACACTCCCGGCCCCT TTAGTGTTGTTTGTAAACAACAAGCCCTTGTTGTTTAATAAAAGCTTTTTTTGTGGAACATAAAAAAAAA AAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_019478
Insert Size 792 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC051673, AAH51673
RefSeq Size 1070 bp
RefSeq ORF 792 bp
Locus ID 54633
UniProt ID Q91VJ5
Gene Summary Intrinsically disordered protein that acts as a scaffold, and which is involved in different processes, such as pre-mRNA splicing, transcription regulation, innate immunity and neuron development (By similarity). Interacts with splicing-related factors via the intrinsically disordered region and regulates alternative splicing of target pre-mRNA species (PubMed:23512658). May suppress the ability of POU3F2 to transactivate the DRD1 gene in a POU3F2 dependent manner (By similarity). Can activate transcription directly or via association with the transcription machinery (By similarity). May be involved in ATXN1 mutant-induced cell death (By similarity). The interaction with ATXN1 mutant reduces levels of phosphorylated RNA polymerase II large subunit (By similarity). Involved in the assembly of cytoplasmic stress granule, possibly by participating to the transport of neuronal RNA granules (By similarity). Also acts as an innate immune sensor of infection by retroviruses, by detecting the presence of reverse-transcribed DNA in the cytosol (By similarity). Directly binds retroviral reverse-transcribed DNA in the cytosol and interacts with CGAS, leading to activate the cGAS-STING signaling pathway, triggering type-I interferon production (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) represents the longest transcript. Variants 1 and 2 encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...