Supt4b (NM_011509) Mouse Untagged Clone

CAT#: MC201808

Gm3258 (untagged) - Mouse predicted gene 3258 (Gm3258), (10ug)



  "NM_011509" in other vectors (6)

CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 100041294; Gm3258; Supt4h1b; Supt4h2
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC024391 sequence for NM_011509
GGAGGAACCTGTGTTGTCGTATCGGTGAGGATGGCCCTGGAGACGGTACCAAAGGACCTGCGGCATCTGC GGGCTTGTTTGCTGTGCTCGTTAGTCAAGACTATAGACCAGTTCGAATATGATGGGTGTGACAATTGCGA TGCATACCTACAAATGAAGGGCAACAGAGAGATGGTTTATGACTGCACCAGCTCTTCATTTGATGGAATC ATTGCGATGATGAGTCCAGAGGACAGCTGGGTCTCCAAGTGGCAGCGAGTCAGTAACTTTAAGCCAGGTG TATATGCTGTGTCCGTCACTGGTCGCCTGCCCCAAGGAATCGTGCGGGAGCTGAAAAGTCGAGGAGTGGC CTACAAATCCAGAGACACAGCAATAAAGACCTAGCTAGGTGCAGGCCATAGCATCTTGTTCTTCACTTCT GTACTTGTTTTCTTGTGGAACTAAACCGTGGGACCCCAAAGACTCCCCGCCCTCCATCTCCGAATCAGCA GACTCCACGAAAGCAGCACATCGGCCTTAAGTCATCTCACTTTCTCTGCCCACTGGTGAAGTGGGAGTGT CTGGGCGGATTCTCAGAGGCTGTGTCAACAGAGGAAGATGCTGATTTCCCACCTGTGTTCAGGGTTTTGC CTTTGTCTATGGGCAGGACTTTGGTTCAAATACCAATAAAGCGAGCCTTTGGAACATAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_011509
Insert Size 354 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC024391, AAH24391
RefSeq Size 770 bp
RefSeq ORF 354 bp
Locus ID 100041294
UniProt ID Q9Z199
Gene Summary Component of the DRB sensitivity-inducing factor complex (DSIF complex), which regulates mRNA processing and transcription elongation by RNA polymerase II. DSIF positively regulates mRNA capping by stimulating the mRNA guanylyltransferase activity of RNGTT/CAP1A. DSIF also acts cooperatively with the negative elongation factor complex (NELF complex) to enhance transcriptional pausing at sites proximal to the promoter. Transcriptional pausing may facilitate the assembly of an elongation competent RNA polymerase II complex. DSIF and NELF promote pausing by inhibition of the transcription elongation factor TFIIS/S-II. TFIIS/S-II binds to RNA polymerase II at transcription pause sites and stimulates the weak intrinsic nuclease activity of the enzyme. Cleavage of blocked transcripts by RNA polymerase II promotes the resumption of transcription from the new 3' terminus and may allow repeated attempts at transcription through natural pause sites (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...