Bst2 (NM_198095) Mouse Untagged Clone

CAT#: MC201626

Bst2 (untagged) - Mouse bone marrow stromal cell antigen 2 (Bst2), (10ug)



  "NM_198095" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Bst2 Antibody
    • 100 ug

CNY 5,808.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms 2310015I10Rik; Bst-2; C87040; CD317; DAMP-1; GREG
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC027328 sequence for NM_198095
GACGCGTGGGCGGACGCGTGGGCGGACGCGTGGGGACGGATCACATGGCGCCCTCTTTCTATCACTATCT GCCCGTGCCCATGGATGAGATGGGGGGGAAGCAAGGATGGGGCAGCCACCGGCAGTGGCTGGGGGCCGCG ATCTTGGTGGTCCTGTTCGGGGTTACCTTAGTCATCCTGACAATCTACTTCGCCGTCACAGCGAACAGCG TGGCCTGTAGAGACGGGTTGCGAGCGCAGGCTGAGTGCCGGAACACCACGCACCTGTTGCAGCGCCAGCT CACCCGCACCCAGGACAGTCTGCTGCAGGCCGAGACACAGGCAAACTCCTGCAACCTGACCGTGGTGACC CTTCAGGAGTCCCTGGAGAAGAAGGTGTCTCAAGCCCTGGAGCAGCAGGCCCGCATCAAGGAGCTTGAGA ATGAAGTCACGAAGCTGAACCAGGAGCTGGAGAATCTGAGGATCCAAAAGGAGACTTCTAGCACAGTGCA GGTGAACTCTGGCAGCTCCATGGTGGTCTCCAGCCTACTGGTGCTCAAAGTGTCACTGTTCCTGCTCTTT TGAGGACTCATTAGTTGGCAGGTCACAGTTGTTTGAAGTCACTATGGGTCATAGTGACTCTGGAGAGGTC CTGGCAGCCCTGAGGATGTGGAAACCACTAGGGGGCTCCAGATTGGGTCTTCCTCCGCAGAACTTTAGGA CTGGGGAGTGGGGAGGGAGTTCTGCTTTATTGCTTTTGCAGTTATTGGGGGGGGTCACATATTTCTGGTG TCTTTGACCTGGAAAAATAAAGTAATTTAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_198095
Insert Size 519 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC027328, AAH27328
RefSeq Size 900 bp
RefSeq ORF 519 bp
Locus ID 69550
UniProt ID Q8R2Q8
Gene Summary IFN-induced antiviral host restriction factor which efficiently blocks the release of diverse mammalian enveloped viruses by directly tethering nascent virions to the membranes of infected cells. Acts as a direct physical tether, holding virions to the cell membrane and linking virions to each other. The tethered virions can be internalized by endocytosis and subsequently degraded or they can remain on the cell surface. In either case, their spread as cell-free virions is restricted. Its target viruses belong to diverse families, including retroviridae: human immunodeficiency virus type 1 (HIV-1), mouse mammary tumor virus (MMTV) and murine leukemia virus (MLV), filoviridae: ebola virus (EBOV), arenaviridae: lassa virus (LASV), and rhabdoviridae: vesicular stomatitis virus (VSV). Can inhibit cell surface proteolytic activity of MMP14 causing decreased activation of MMP15 which results in inhibition of cell growth and migration. Can stimulate signaling by LILRA4/ILT7 and consequently provide negative feedback to the production of IFN by plasmacytoid dendritic cells in response to viral infection. Plays a role in the organization of the subapical actin cytoskeleton in polarized epithelial cells.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...