United States
Germany
Japan
United Kingdom
China
Coa3 (NM_026618) Mouse Untagged Clone
CAT＃: MC201347
Coa3 (untagged) - Mouse coiled-coil domain containing 56 (Ccdc56), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 1810033A19Rik; Ccdc56; D11Ertd99e; HSPC009 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC026206 sequence for NM_026618
GGGCGGAGCAGCAACATGGCGGCCCCTGGAGCTGGTGACCCTCTGAATGCTAAGAATGGAAATGCTCCAT TCGCTCAGCGCATCGACCCGTCGCGGGAGAAATTGACCCCAGCGCAGTTGCAGTTTATGCGGCAGGTGCA ACTTGCCCAGTGGCAGAAAACACTGCCACAGCGGCGGACCCGGAACATCATGACCGGCCTGGGCATCGGG GCCCTGGTGTTAGCTATTTATGGTTACACCTTCTACTCGGTGGCCCAAGAGCGTTTCCTTGATGAGCTGG AAGATGAAGCCAAAGCTGCCCGAGCCCGTGCTCTTGAGAGAGAGCGAGCTTCGGGACCCTAACTGTATGG ACCATCTTCAAACTGCTGGATCCCCTGTATATGTTGAATGATGCCTGGTGGTCTTACAGCATCACTGGCA CACTAACGTCGGACTGTGTGATTGAGCCCAAGAAGCCAGAGACTATGCATTTGGCCGCTGCCAAGGGGGG GATTGCTCACTTCACGTGCAGTTTGTCCAGTTACTCAGCCCTTTTTATTTCCTTGTTTGAGAGGTATGCA ACCTTGCCTTTACCCAAACTTTGTGGTTTACCCCTTCACCTCCCAGGGGCCCCGACTCTTAAGGGGGAGG GTGTGGCTTAACTGCAGCGTTGGAACCTTAAAGTGGGAAAGATAGGGTCAAGTTAAAGTAATAAAATGAG TCATGTCTCCCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | EcoRI-NotI |
| ACCN | NM_026618 |
| Insert Size | 327 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC026206, AAH26206 |
| RefSeq Size | 744 bp |
| RefSeq ORF | 327 bp |
| Locus ID | 52469 |
| UniProt ID | Q9D2R6 |
| Gene Summary | Core component of the MITRAC (mitochondrial translation regulation assembly intermediate of cytochrome c oxidase complex) complex, that regulates cytochrome c oxidase assembly. MITRAC complexes regulate both translation of mitochondrial encoded components and assembly of nuclear-encoded components imported in mitochondrion. Required for efficient translation of MT-CO1 and mitochondrial respiratory chain complex IV assembly.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200392 | Coa3 (tGFP-tagged) - Mouse coiled-coil domain containing 56 (Ccdc56) |
CNY 2,850.00 |
|
| MR200392 | Coa3 (Myc-DDK-tagged) - Mouse coiled-coil domain containing 56 (Ccdc56) |
CNY 1,200.00 |
|
| MR200392L3 | Lenti ORF clone of Coa3 (Myc-DDK-tagged) - Mouse coiled-coil domain containing 56 (Ccdc56) |
CNY 4,750.00 |
|
| MR200392L4 | Lenti ORF clone of Coa3 (mGFP-tagged) - Mouse coiled-coil domain containing 56 (Ccdc56) |
CNY 4,750.00 |
