Tesc (NM_021344) Mouse Untagged Clone
CAT#: MC201246
Tesc (untagged) - Mouse tescalcin (Tesc), (10ug)
CNY 2,400.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1010001A17Rik; 2410011K10Rik; TE-1 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC019492 sequence for NM_021344
GGAACCGGCTCCGCGCCGCTGTCCCCGCGTCCCCACCCGGCTCCAGCGCAGCGCAGCCCAGGCAGTCCCC GGCCTGCGTGGGGCGCCCGGGGCCCCGCGGCGCACCATGGGCGCTGCCCACTCGGCGTCCGAGGAGGTGC GGGAGCTCGAGGGCAAGACCGGCTTCTCCTCGGACCAGATAGAGCAGCTGCATCGGAGGTTCAAGCAGCT AAGCGGGGACCAGCCCACCATTCGCAAGGAGAACTTCAACAATGTCCCTGACCTGGAGCTCAACCCGATC CGATCCAAAATCGTCCGTGCCTTCTTCGACAACAGGAACCTGCGAAAGGGATCCAGCGGTCTGGCCGATG AGATCAACTTTGAGGACTTCCTGACTATCATGTCCTACTTCCGGCCCATCGACACCACCCTGGGCGAGGA ACAGGTGGAGCTGTCACGAAAGGAGAAGCTGAAATTTCTGTTTCATATGTATGATTCGGACAGTGACGGC CGCATCACCCTGGAAGAGTATAGAAATGTGGTGGAGGAGCTGCTCTCGGGAAACCCTCACATTGAAAAGG AGTCGGCTCGGTCCATTGCAGACGGGGCCATGATGGAGGCGGCCAGCGTGTGCGTGGGGCAGATGGAACC GGACCAGGTGTACGAGGGGATCACCTTTGAGGACTTCCTGAAGATCTGGCAGGGCATCGACATCGAGACC AAGATGCACATTCGTTTCCTCAACATGGAGACCATCGCCCTCTGCCACTGACCTGCTGCCTGCTGCCCGT GCAAGGGAGGGGGTGGCTGGAAGCTGGGGGTGACCGAGGACGGATGTTCAGCCCTATGCCTGGGCTTCTG TGACAATCAGTAACCCTTCTTCAGTTATCCTCCTCGTGGGGTGTGGTGTGTGGGACTCCGATATTTTTAT CTCTAATGGTGACAATAAAGGTTTCCTAATGAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_021344 |
Insert Size | 645 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC019492, AAH19492 |
RefSeq Size | 957 bp |
RefSeq ORF | 645 bp |
Locus ID | 57816 |
UniProt ID | Q9JKL5 |
Gene Summary | Functions as an integral cofactor in cell pH regulation by controlling plasma membrane-type Na(+)/H(+) exchange activity. Promotes the maturation, transport, cell surface stability and exchange activity of SLC9A1/NHE1 at the plasma membrane. Promotes the induction of hematopoietic stem cell differentiation toward megakaryocytic lineage. Essential for the coupling of ERK cascade activation with the expression of ETS family genes in megakaryocytic differentiation. Also involved in granulocytic differentiation in a ERK-dependent manner. Inhibits the phosphatase activity of calcineurin.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the protein-coding transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG202345 | Tesc (tGFP-tagged) - Mouse tescalcin (Tesc) |
CNY 2,850.00 |
|
MR202345 | Tesc (Myc-DDK-tagged) - Mouse tescalcin (Tesc) |
CNY 2,400.00 |
|
MR202345L3 | Lenti ORF clone of Tesc (Myc-DDK-tagged) - Mouse tescalcin (Tesc) |
CNY 4,750.00 |
|
MR202345L4 | Lenti ORF clone of Tesc (mGFP-tagged) - Mouse tescalcin (Tesc) |
CNY 4,750.00 |