Mdk (NM_001012336) Mouse Untagged Clone

CAT#: MC201056

Mdk (untagged) - Mouse midkine (Mdk), transcript variant 3, (10ug)



CNY 1,200.00

CNY 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms Mek; MK
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC012244 sequence for NM_001012336
AAACCGAACTCCAGGACCAGAGACCCAGAGATCAGAGGATGCAGCACCGAGGCTTCTTCCTTCTCGCCCT TCTTGCCCTCTTGGTGGTCACGTCCGCGGTGGCCAAAAAAAAAGAGAAGGTGAAGAAGGGCAGCGAGTGT TCGGAGTGGACCTGGGGGCCCTGCACCCCCAGCAGCAAGGACTGCGGCATGGGCTTCCGCGAGGGTACCT GTGGGGCCCAGACCCAGCGCGTCCATTGCAAGGTGCCCTGCAACTGGAAGAAGGAATTTGGAGCCGACTG CAAATACAAGTTTGAGAGCTGGGGGGCGTGTGATGGGAGCACTGGCACCAAAGCCCGCCAAGGGACCCTG AAGAAGGCGCGGTACAATGCCCAGTGCCAGGAGACCATCCGCGTGACTAAGCCCTGCACCTCCAAGACCA AGTCAAAGACCAAAGCCAAGAAAGGAAAAGGAAAGGACTAAGTCAGGAGGCCAGAGAGCCTCCGGCCTCG CCTGGAGCCTGAACGGAGCCCTCCTCTCCCACAGGCCCAAGATATAACCCACCAGTGCCTTTTGTCTTCC TGTCAGCTCTGTCAATCACGCCTGTCCTCTCACGCCCACACCAAGTGCCCAAAGTGGGGAGGGACAAGAG ATTCTGGAAAGTGAGCCTCCCCATACCCTCTTTTGTTCTCCCCACCCTGATACTTGCTATTAAGAAATGA ATAAAATAAACTCACTTTTTTCCAATAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_001012336
Insert Size 423 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC012244, AAH12244
RefSeq Size 753 bp
RefSeq ORF 423 bp
Locus ID 17242
UniProt ID P12025
Gene Summary This gene encodes a secreted growth factor that belongs to the pleiotrophin/midkine heparin-binding protein family and functions in a variety of biological processes. The encoded cytokine promotes the growth, differentiation, survival and migration of several target cells including leucocytes involved in inflammation. This protein plays a role in the formation of scar tissue and intraperitoneal adhesions, and promotes neurite outgrowth and neuron survival. The protein encoded by this gene is associated with obesity and inhibition of insulin signaling in fat cells. A pseudogene of this gene is present on chromosome 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
Transcript Variant: This variant (3, also known as MK2; PMID 2345177) differs in the 5' UTR compared to variant 1. Variants 1 through 4 encode the same isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...