Tgfb2 (NM_009367) Mouse Untagged Clone
CAT#: MC200993
Tgfb2 (untagged) - Mouse transforming growth factor, beta 2 (Tgfb2), (10ug)
CN¥ 5,488.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | BB105277; Tgf-beta; Tgf-beta2; Tgfb-2 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC011170 sequence for NM_009367
CTGCTTTGCAAAAGTTTCGTATTAAAAACAACTCTACCTGACCGCTCTGAGAATTACTAGTTTCTTTTTT ATATATATTTTTTCTTACTTTAAATAACAACATCAACGTTTCTTCCTTTTAAAAACATGCACTACTGTGT GCTGAGCACCTTTTTGCTCCTGCATCTGGTCCCGGTGGCGCTCAGTCTGTCTACCTGCAGCACCCTCGAC ATGGATCAGTTTATGCGCAAGAGGATCGAGGCCATCCGCGGGCAGATCCTGAGCAAGCTGAAGCTCACCA GCCCCCCGGAAGACTATCCGGAGCCGGATGAGGTCCCCCCGGAGGTGATTTCCATCTACAACAGTACCAG GGACTTACTGCAGGAGAAGGCAAGCCGGAGGGCAGCCGCCTGCGAGCGCGAGCGGAGCGACGAGGAGTAC TACGCCAAGGAGGTTTATAAAATCGACATGCCGTCCCACCTCCCCTCCGAAAATGCCATCCCGCCCACTT TCTACAGACCCTACTTCAGAATCGTCCGCTTTGATGTCTCAACAATGGAGAAAAATGCTTCGAATCTGGT GAAGGCAGAGTTCAGGGTCTTCCGCTTGCAAAACCCCAAAGCCAGAGTGGCCGAGCAGCGGATTGAACTG TATCAGATCCTTAAATCCAAAGACTTAACATCTCCCACCCAGCGCTACATCGATAGCAAGGTTGTGAAAA CCAGAGCGGAGGGTGAATGGCTCTCCTTCGACGTGACAGACGCTGTGCAGGAGTGGCTTCACCACAAAGA CAGGAACCTGGGGTTTAAAATAAGTTTACACTGCCCCTGCTGTACCTTCGTGCCGTCTAATAATTACATC ATCCCGAATAAAAGCGAAGAGCTCGAGGCGAGATTTGCAGGTATTGATGGCACCTCTACATATGCCAGTG GTGATCAGAAAACTATAAAGTCCACTAGGAAAAAAACCAGTGGGAAGACCCCACATCTCCTGCTAATGTT GTTGCCCTCCTACAGACTGGAGTCACAACAGTCCAGCCGGCGGAAGAAGCGCGCTTTGGATGCTGCCTAC TGCTTTAGAAATGTGCAGGATAATTGCTGCCTTCGCCCTCTTTACATTGATTTTAAGAGGGATCTTGGAT GGAAATGGATCCATGAACCCAAAGGGTACAATGCTAACTTCTGTGCTGGGGCATGCCCATATCTATGGAG TTCAGACACTCAACACACCAAAGTCCTCAGCCTGTACAACACCATAAATCCCGAAGCTTCCGCTTCCCCT TGCTGTGTGTCCCAGGATCTGGAACCACTGACCATTCTCTATTACATTGGAAATACGCCCAAGATCGAAC AGCTTTCCAATATGATTGTCAAGTCTTGTAAATGCAGCTAAAGTCCTTGGGAAAGCCAGGACACGAAAAT CACGGTGACAATGACATATAATGACAACGATGACGACCATGATGTTTGTGACAGGAGGGAGGGAGTTTTG ATTCATCAGTGTTTAAAAAAAAAAAAATTGGAGAAAAAAAATCGGTACTAGTTCAAACATTTTGCAAGCT TGTGTTCTGTTTGTTAAAACTGGCATCTGAGATTACAGCAACAACAACCACAAAAATGGAAGGCGTTAGT CTGCATCTCACCTACTTCCTAAGAGACACAAAAAGAAAACATCTTTTTTTTTTTTTTAAGGAAAAAAATA AACACTGGAAGAATTTGTTAGTGTTAATTATGTGAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_009367 |
Insert Size | 1245 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC011170, AAH11170 |
RefSeq Size | 1741 bp |
RefSeq ORF | 1245 bp |
Locus ID | 21808 |
UniProt ID | P27090 |
Gene Summary | This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. Mice lacking a functional copy of this gene display developmental defects in multiple organs and perinatal lethality. Heterozygous mutant mice exhibit aortic root aneurysm. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016] Transcript Variant: This variant (1) represents the shorter transcript and encodes the shorter isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG225633 | Tgfb2 (tGFP-tagged) - Mouse transforming growth factor beta 2 (Tgfb2), (10ug) |
CN¥ 7,088.00 |
|
MR225633 | Tgfb2 (Myc-DDK-tagged) - Mouse transforming growth factor, beta 2 (Tgfb2) |
CN¥ 5,488.00 |
|
MR225633L3 | Lenti ORF clone of Tgfb2 (Myc-DDK-tagged) - Mouse transforming growth factor, beta 2 (Tgfb2) |
CN¥ 7,888.00 |
|
MR225633L4 | Lenti ORF clone of Tgfb2 (mGFP-tagged) - Mouse transforming growth factor, beta 2 (Tgfb2) |
CN¥ 5,990.00 |