United States
Germany
Japan
United Kingdom
China
Ercc1 (NM_007948) Mouse Untagged Clone
CAT＃: MC200987
Ercc1 (untagged) - Mouse excision repair cross-complementing rodent repair deficiency, complementation group 1 (Ercc1), transcript variant 1, (10ug)
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | Ercc-1 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC011224 sequence for NM_007948
GAAGTGAGTCTAGCAGGAGTTGTGCTGGCTGTGCTGGCGTTGTGTCGCCTCTGTTTCCCCCCGTGGTATT TCCTTCTAGGCATCGGGAAAGACCAGGCCCCAGATGGACCCTGGGAAGGACGAGGAAAGTCGGCCACAGC CCTCAGGACCACCCACCAGGAGGAAGTTTGTTATCCCACTGGAGGAAGAAGAGGTGCCCTGTGCAGGGGT CAAGCCCTTATTCAGATCGTCACGGAATCCCACCATCCCAGCAACCTCAGCCCACGTGGCCCCTCAGACG TATGCTGAGTACGCCATCACCCAGCCTCCAGGAGGGGCTGGGGCCACAGTGCCCACAGGCTCTGAACCTG CGGCAGGAGAGAACCCCAGCCAGACCCTGAAAACAGGAGCAAAGTCTAATAGCATCATCGTGAGCCCGAG GCAGAGGGGCAACCCCGTGTTGAAGTTTGTGCGCAATGTGCCCTGGGAATTCGGTGAGGTGATTCCCGAT TATGTGCTGGGCCAGAGCACCTGCGCCCTTTTCCTCAGCCTCCGCTACCACAACCTCCATCCAGACTACA TCCATGAACGGCTGCAGAGCCTGGGGAAGAACTTCGCCCTTCGTGTGCTGCTGGTTCAAGTGGATGTGAA AGATCCCCAGCAGGCTCTCAAGGAGCTGGCTAAGATGTGCATCTTGGCTGACTGCACCCTGGTCCTGGCC TGGAGTGCAGAGGAAGCAGGGCGGTACCTGGAGACCTACAAGGCGTATGAGCAGAAGCCAGCCGACCTCC TTATGGAAAAGCTGGAGCAGAACTTCCTATCACGGGCCACTGAGTGTCTGACCACCGTGAAATCTGTGAA CAAGACCGACAGCCAGACCCTCCTGGCTACATTTGGATCCCTGGAACAGCTCTTCACCGCATCAAGGGAG GATCTAGCCTTATGCCCGGGCCTGGGCCCACAGAAGGCCCGCAGGCTCTTTGAAGTACTACACGAACCCT TCCTCAAAGTGCCTCGATGACCTGCTGCCACCTAGGCCCAGTGTCACAATAAAGAATTTTCCATGCCCAG GCAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_007948 |
| Insert Size | 897 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC011224, AAH11224 |
| RefSeq Size | 1067 bp |
| RefSeq ORF | 897 bp |
| Locus ID | 13870 |
| UniProt ID | P07903 |
| Gene Summary | Non-catalytic component of a structure-specific DNA repair endonuclease responsible for the 5'-incision during DNA repair. Responsible, in conjunction with SLX4, for the first step in the repair of interstrand cross-links (ICL). Participates in the processing of anaphase bridge-generating DNA structures, which consist in incompletely processed DNA lesions arising during S or G2 phase, and can result in cytokinesis failure. Also required for homology-directed repair (HDR) of DNA double-strand breaks, in conjunction with SLX4 (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer protein (isoform a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG204140 | Ercc1 (tGFP-tagged) - Mouse excision repair cross-complementing rodent repair deficiency, complementation group 1 (Ercc1) |
CNY 5,200.00 |
|
| MR204140 | Ercc1 (Myc-DDK-tagged) - Mouse excision repair cross-complementing rodent repair deficiency, complementation group 1 (Ercc1), transcript variant 1 |
CNY 3,600.00 |
|
| MR204140L3 | Lenti ORF clone of Ercc1 (Myc-DDK-tagged) - Mouse excision repair cross-complementing rodent repair deficiency, complementation group 1 (Ercc1), transcript variant 1 |
CNY 5,890.00 |
|
| MR204140L4 | Lenti ORF clone of Ercc1 (mGFP-tagged) - Mouse excision repair cross-complementing rodent repair deficiency, complementation group 1 (Ercc1), transcript variant 1 |
CNY 5,890.00 |
