United States
Germany
Japan
United Kingdom
China
Med21 (NM_025315) Mouse Untagged Clone
CAT＃: MC200870
Med21 (untagged) - Mouse mediator complex subunit 21 (Med21), (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | 0610007L03Rik; AI449604; D6Ertd782e; D19234; Srb7; Surb7 |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC012286 sequence for NM_025315
CCCACGCGTCCGGCGTGGTGAACATGGCGGATAGACTCACTCAGCTGCAGGACGCTGTGAACTCGCTTGC AGATCAGTTTTGTAATGCCATTGGTGTATTACAGCAGTGTGGTCCTCCTGCCTCTTTTAGTAACATTCAA ACAGCAATTAATAAAGATCAACCAGCCAATCCTACAGAAGAGTATGCTCAGCTTTTTGCAGCACTGATTG CACGAACAGCAAAAGATATTGATGTTTTGATAGATTCCTTACCCAGTGAAGAGTCTACAGCTGCTTTACA GGCTGCTAGCTTATATAAGCTAGAAGAAGAAAATCACGAAGCTGCTACATGTCTGGAGGATGTTGTTTAT CGAGGAGACATGCTTCTGGAGAAGATCCAAAGTGCACTTGCTGACATTGCACAGTCACAGCTGAAGACCA GAAGTGTTACCCGTAGTCACTCTCTCCCAGACTCATAGCATCAACTGCTAAGATGTGACAGAGAAAAGAA CTGTTTGAATGGCATTAAGAATGCTGCATCATACGCTATGACTGTGTTGCCTTTTTTTTTAGCTAGTTTT CATTGTGTTCTGTTTTCACTCTTGATAAGTAAAAAGCTCTGAAATTGCCACTGACTCATCTTCAAACATC ATTATGCCATTTTTTATCTGACTAGAATTTTCAGGATAGATACTGTACTAATAAGGTTCATGATATAATT AAACAGATATACAATAAAGCTCTTTGTTGTTTTGTGAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_025315 |
| Insert Size | 435 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC012286, AAH12286 |
| RefSeq Size | 759 bp |
| RefSeq ORF | 435 bp |
| Locus ID | 108098 |
| UniProt ID | Q9CQ39 |
| Gene Summary | Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG200953 | Med21 (tGFP-tagged) - Mouse SRB7 (suppressor of RNA polymerase B) homolog (S |
CNY 2,850.00 |
|
| MR200953 | Med21 (Myc-DDK-tagged) - Mouse mediator complex subunit 21 (Med21) |
CNY 1,200.00 |
|
| MR200953L3 | Lenti ORF clone of Med21 (Myc-DDK-tagged) - Mouse mediator complex subunit 21 (Med21) |
CNY 4,750.00 |
|
| MR200953L4 | Lenti ORF clone of Med21 (mGFP-tagged) - Mouse mediator complex subunit 21 (Med21) |
CNY 4,750.00 |
