Pcna (NM_011045) Mouse Untagged Clone

CAT#: MC200713

Pcna (untagged) - Mouse proliferating cell nuclear antigen (Pcna), (10ug)



  "NM_011045" in other vectors (4)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC005778 sequence for NM_011045
GCGCAGAGGGTTGGTAGTTGTCGCTGTAGGCCTTCGCTGCCGCTTCTGCATCGTGAATCGGGGGACCTTG GCAGCCAGACCTCGTTCCTCTTAGAGTAGCTCTCATCTAGTCGCCACAACTCCGCCACCATGTTTGAGGC ACGCCTGATCCAGGGCTCCATCCTGAAGAAGGTGCTGGAGGCTCTCAAAGACCTCATCAATGAGGCCTGC TGGGACGTCAGCTCGGGCGGCGTGAACCTGCAGAGCATGGACTCGTCTCACGTCTCCTTGGTACAGCTTA CTCTGCGCTCCGAAGGCTTCGACACATACCGCTGCGACCGCAACCTAGCCATGGGCGTGAACCTCACCAG CATGTCCAAAATTCTAAAATGTGCTGGTAATGAAGACATCATTACATTAAGGGCTGAAGATAATGCAGAC ACCTTAGCACTAGTATTCGAAGCACCAAATCAAGAGAAAGTTTCAGACTATGAAATGAAGTTAATGGACT TAGATGTGGAGCAACTTGGAATCCCAGAACAGGAGTACAGCTGTGTAATAAAGATGCCGTCGGGTGAATT TGCACGTATATGCCGAGACCTTAGCCACATTGGAGATGCTGTTGTGATATCCTGTGCAAAGAATGGGGTG AAGTTTTCTGCAAGTGGAGAGCTTGGCAATGGGAACATTAAGTTGTCACAAACAAGTAATGTGGATAAAG AAGAGGAGGCGGTAACCATAGAGATGAATGAGCCTGTTCACCTAACGTTTGCTCTGAGGTACCTGAACTT TTTCACAAAAGCCACTCCACTGTCTCCTACAGTAACACTCAGTATGTCTGCAGATGTGCCCCTTGTTGTA GAGTATAAAATTGCTGACATGGGACACTTAAAGTATTATTTGGCTCCCAAGATTGAAGATGAGGAAGCAT CTTAGGCATTGCTAGAAATTGAGAAAACTAAACCTTTGAAGATTGCTCCTGAGATGCCAGCGTGTCCTGA GGTCTTTTCTGTCACCAAGTTTGTACCTGAGTATTCTTAAATATTAAAATAAAATATGTAGATATCTTCT GTAAATAACCTACTTTCTTTTCTCTCCATTCTCCATAATTTGCTTAAAGAATAAGCTCCAAAGTAAAAAC TAGTTTTGTTAACATGAATGTTTCTGCTTTACAAATACTGGTGATTTTCATCAATGATCTTGACGCTAAA TGCAGTTTTAAGAAATATTGTTCAATTTAAATAAAGTTAACAATTTGAAAAGTCAAAAAAAAAAAAAAAA A
Restriction Sites RsrII-NotI     
ACCN NM_011045
Insert Size 786 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC005778, AAH05778
RefSeq Size 1261 bp
RefSeq ORF 786 bp
Locus ID 18538
UniProt ID P17918
Gene Summary Auxiliary protein of DNA polymerase delta and is involved in the control of eukaryotic DNA replication by increasing the polymerase's processibility during elongation of the leading strand. Induces a robust stimulatory effect on the 3'-5' exonuclease and 3'-phosphodiesterase, but not apurinic-apyrimidinic (AP) endonuclease, APEX2 activities. Has to be loaded onto DNA in order to be able to stimulate APEX2. Plays a key role in DNA damage response (DDR) by being conveniently positioned at the replication fork to coordinate DNA replication with DNA repair and DNA damage tolerance pathways. Acts as a loading platform to recruit DDR proteins that allow completion of DNA replication after DNA damage and promote postreplication repair: Monoubiquitinated PCNA leads to recruitment of translesion (TLS) polymerases, while 'Lys-63'-linked polyubiquitination of PCNA is involved in error-free pathway and employs recombination mechanisms to synthesize across the lesion (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...