Ndufa2 (NM_010885) Mouse Untagged Clone
CAT#: MC200552
Ndufa2 (untagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2 (Ndufa2), nuclear gene encoding mitochondrial protein, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | AV000592; B8; C1-B8; CI-B8 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC006815 sequence for NM_010885
CAAAGATGGCGGCTGCCGCTGCTAGCCGAGCGGTCGGCGCAAAGCTGGGGTTGCGTGAGATTCGCGTTCA CTTATGCCAGCGTTCCCCAGGCAGCCAGGGTGTGAGGGATTTCATCGTGCAACGGTACGTGGAGCTGAAG AAGGCGCACCCCAACCTGCCCATTCTGATCCGCGAATGCTCGGAGGTGCAGCCCAAGCTTTGGGCCCGCT ATGCTTTTGGCCAAGAGAAGACGGTGTCTCTGAACAATCTGAGTGCTGATGAGGTAACCAGAGCCATGCA GAATGTGCTAAGCGGCAAAGCCTGAAGGTCTCCACTGAGGACTGTGAGCGAGAGCAGCTGAACCTGCTGG ACTGAAGACAGTGTGGGGAAATGTGTGCTTTGGGTCCTTATAAAGCTTACGCTGTACAGTGAAAAAAAAA AAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_010885 |
Insert Size | 300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC006815, AAH06815 |
RefSeq Size | 426 bp |
RefSeq ORF | 300 bp |
Locus ID | 17991 |
UniProt ID | Q9CQ75 |
Gene Summary | This gene encodes a subunit of the NADH-ubiquinone oxidoreductase (complex I) enzyme, which is a large, multimeric protein. It is the first enzyme complex in the mitochondrial electron transport chain and catalyzes the transfer of electrons from NADH to the electron acceptor ubiquinone. The proton gradient created by electron transfer drives the conversion of ADP to ATP. The human ortholog of this gene has been characterized, and its structure and redox potential is reported to be similar to that of thioredoxins. It may be involved in regulating complex I activity or assembly via assistance in redox processes. In humans, mutations in this gene are associated with Leigh syndrome, an early-onset progressive neurodegenerative disorder. A pseudogene of this gene is located on chromosome 5. [provided by RefSeq, May 2013] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200299 | Ndufa2 (tGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2 (Ndufa2) |
CNY 2,850.00 |
|
MR200299 | Ndufa2 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2 (Ndufa2), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
|
MR200299L3 | Lenti ORF clone of Ndufa2 (Myc-DDK-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2 (Ndufa2), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |
|
MR200299L4 | Lenti ORF clone of Ndufa2 (mGFP-tagged) - Mouse NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 2 (Ndufa2), nuclear gene encoding mitochondrial protein |
CNY 4,750.00 |