Rpsa (BC003829) Mouse Untagged Clone

CAT#: MC200489

Rpsa (untagged) - Mouse ribosomal protein SA (cDNA clone MGC:6243 IMAGE:3600738), (10ug)



  "BC003829" in other vectors (1)

CNY 2,400.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-Rpsa Antibody
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms MLR, P40, 67kDa
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC003829
GGGGACGGGTCCATACGGCGTTGTTCTTGATTCCCATCGTAACTTAAAGGGAAACTTACACAATGTCCGG AGCCCTTGACGTCCTGCAGATGAAGGAGGAGGATGTCCTCAAATTCCTTGCTGCGGGAACCCACTTAGGT GGCACCAACCTTGACTTTCAGATGGAGCAGTACATCTACAAAAGGAAAAGTGACGGTATCTACATCATAA ACCTGAAGAGGACCTGGGAGAAGCTGTTGCTCGCAGCTCGAGCTATTGTTGCCATCGAGAATCCTGCTGA CGTCAGCGTCATCTCCTCCAGGAACACTGGCCAGCGAGCTGTGCTGAAGTTTGCTGCTGCCACAGGAGCC ACTCCGATCGCTGGCCGCTTCACACCTGGGACCTTCACTAACCAGATCCAAGCAGCCTTCAGGGAGCCAC GGCTTCTAGTGGTGACCGATCCCAGGGCTGACCATCAGCCACTCACAGAGGCCTCTTATGTCAACCTGCC CACCATTGCTCTGTGTAACACAGATTCTCCCCTGCGCTATGTGGACATTGCCATCCCATGCAACAACAAG GGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTGGCCAGGGAAGTACTCCGCATGCGAGGTACTATCT CCCGTGAGCACCCCTGGGAGGTCATGCCTGATCTTTACTTCTACAGAGACCCAGAGGAGATTGAGAAGGA GGAGCAGGCTGCTGCTGAGAAGGCTGTGACCAAGGAGGAATTCCAGGGTGAATGGACCGCACCAGCTCCT GAGTTCACTGCTGCTCAGCCTGAGGTGGCCGACTGGTCTGAGGGTGTGCAGGTTCCCTCTGTGCCCATCC AGCAGTTCCCCACGGAAGACTGGAGTGCACAGCCAGCCACTGAGGATTGGTCAGCAGCTCCCACAGCGCA GGCCACTGAGTGGGTTGGAGCCACCACTGAGTGGTCCTGAGCTGCTGTGCAGGTGCCTGAGCAAAGGGAA AAAAAGATGGAAGGAAAATAAAGTTGCTAAAAGCTGTCTTATGGTCCTCAAAAAAAAAAAAAAAAAAAAA AAAA
Restriction Sites RsrII-NotI     
ACCN BC003829
Insert Size 888 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC003829, AAH03829
RefSeq Size 1054 bp
RefSeq ORF 888 bp
Locus ID 16785
Gene Summary Required for the assembly and/or stability of the 40S ribosomal subunit. Required for the processing of the 20S rRNA-precursor to mature 18S rRNA in a late step of the maturation of 40S ribosomal subunits. Also functions as a cell surface receptor for laminin. Plays a role in cell adhesion to the basement membrane and in the consequent activation of signaling transduction pathways. May play a role in cell fate determination and tissue morphogenesis. Also acts as a receptor for several other ligands, including the pathogenic prion protein, viruses, and bacteria. Acts as a PPP1R16B-dependent substrate of PPP1CA (By similarity). Enables malignant tumor cells to penetrate laminin tissue and vessel barriers. Activates precursor thymic anti-OFA/iLRP specific cytotoxic T-cell. May induce CD8 T-suppressor cells secreting IL-10.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...