Prdx2 (BC002034) Mouse Untagged Clone

CAT#: MC200303

Prdx2 (untagged) - Mouse peroxiredoxin 2 (cDNA clone MGC:5935 IMAGE:3485635), (10ug)



CNY 2,400.00


货期*
现货

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (4)
PRDX2 Antibody - C-terminal region
    • 50 ug

CNY 4,628.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms TR, TPx, TSA, TDX1, NkefB, PRP, TPx-B, Torin, Band-8
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC002034
CGGACGCGTGGGTTTGGGCCACGCATAAAAGGTTCTCCGGCCTAGGGCTCTCTCGGTTTTGAGATCTCTT TCCTGTCTCTACCCGTGTCTGGACGTCCGTGTGTCCGGCTCTTGCTCACGCAGTCATGGCCTCCGGCAAC GCGCAAATCGGAAAGTCGGCTCCTGACTTCACGGCCACAGCGGTGGTGGATGGTGCCTTCAAGGAAATCA AGCTTTCGGACTACAGAGGGAAGTACGTGGTCCTCTTTTTCTACCCACTGGACTTCACTTTTGTTTGCCC CACGGAGATCATCGCTTTTAGCGACCATGCTGAGGACTTCCGAAAGCTAGGCTGCGAGGTGCTGGGAGTG TCTGTGGACTCTCAGTTCACCCACCTGGCGTGGATCAATACCCCACGGAAAGAGGGAGGCTTGGGCCCCC TGAATATCCCTCTGCTTGCTGACGTGACTAAAAGCTTGTCCCAGAATTACGGCGTGTTGAAAAATGATGA GGGCATTGCTTACAGGGGTCTCTTTATCATCGATGCCAAGGGTGTCCTTCGCCAGATCACAGTCAATGAC CTACCTGTGGGACGCTCTGTAGACGAGGCTCTCCGCCTAGTCCAGGCCTTTCAGTATACAGACGAGCATG GGGAAGTCTGCCCTGCTGGCTGGAAGCCCGGCAGTGACACCATCAAGCCCAATGTGGATGACAGCAAGGA ATACTTCTCCAAACACAACTGAGATGGGTAAACATCGGTGAGCCTGAAGCTTGGATTTCACCTGTGCCCC AACCTGGATGTCCTGTGCTGGCCCAGAAAATGCTAGATTTTCCTCCACTCTCTGAAGGGGCTGGAGTCTA GGCTGAGGCTTTCTCATTACCCACCTGGAATCTGGTGAATAGTGATCCTGCCCTGAGCACACCTAGCTGG GCCCAGGTCTATAGGAAACCAATAAAGTATTAGGGACAGTGTAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN BC002034
Insert Size 597 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC002034, AAH02034
RefSeq Size 968 bp
RefSeq ORF 597 bp
Locus ID 21672
Gene Summary Thiol-specific peroxidase that catalyzes the reduction of hydrogen peroxide and organic hydroperoxides to water and alcohols, respectively. Plays a role in cell protection against oxidative stress by detoxifying peroxides and as sensor of hydrogen peroxide-mediated signaling events. Might participate in the signaling cascades of growth factors and tumor necrosis factor-alpha by regulating the intracellular concentrations of H(2)O(2).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Customer Reviews 
Loading...