Kcne3 (NM_020574) Mouse Untagged Clone
CAT#: MC200237
Kcne3 (untagged) - Mouse potassium voltage-gated channel, Isk-related subfamily, gene 3 (Kcne3), transcript variant 2, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2210017H05Rik; MiRP2 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC004629 sequence for NM_020574
TCCGAGAGCACTGAGCGCATCTGGGCATTATTGCAGTGTTCACCGGAGACAGATCGTAGAGGCGGGGCTC TGCCACGTCCATCCTGGAAACTTGATAATCAATGACTCTCTAGGAGTTGGAAATCCGGGGACTCAAGGAA GAGAAACAAAACACCAGTGTTTCTGTCTGTGCCCATTTGGAACCAAGAGTTTCTAGCTCTGGGCCTTTCC TGTTAACACCACGACTCTGGCTGCTTCCAGATGCACCTTGCAAGGAACTGAGGGGTTGTGGGACATCCAC GAAGAGATCCTCAAAGATGTCTCAGAGCCAGCAGAGTCTCTGAACTGTTTGATCACATTCCAGCTCTTCC CATACCTCAATATCTGTTGCTATGGAGACTTCCAACGGGACTGAGACCTGGTACATGAGCCTCCATGCTG TGCTGAAGGCTCTGAACACAACCCTTCACAGTCACTTGCTCTGCCGGCCTGGGCCAGGACCAGGGCCAGA CAATCAAACTGAGGATCGTCGGGCTAGCCTTCCTGGTCGTAATGACAACTCCTACATGTATATTCTCTTT GTCATGTTCCTATTTGCCGTCACTGTGGGCAGTCTCATCCTGGGATATACCCGTTCACGCAAAGTGGACA AACGTAGTGACCCCTATCATGTGTACATCAAGAACCGTGTGTCTATGATCTGATGTGAGGAACCTGAAGA CAATGGAAGATTACAATGTCTGAGGATTGTCTTCTGGTGCCTCCGGAGCTCAACTCAACCATATCAAGCC ACAGTGTATCTATGTAAGATCAACAGGAAACTGGTAAGAGGGTTAGGTCATTATTAGGACCAGAGAAGAG GGACTGATAGGCCCAGTCTTGTGGATGAGACATTTTTCGAGACACAGATGCGCATTATAAACTCAGAGCC CATGAACACACATATATAAAGTATGGACAACCAGCAAGTAGAAGAGGAAGCTGTGGCGAAGGGAAATGGG GCAGAAAGATGCTCTGGATATATAATCTTTTAATGTATGATCTTCAACATGAGAAACCTTGATAAAACTG AGAATGCTAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_020574 |
Insert Size | 312 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC004629, AAH04629 |
RefSeq Size | 1073 bp |
RefSeq ORF | 312 bp |
Locus ID | 57442 |
UniProt ID | Q9WTW2 |
Gene Summary | Ancillary protein that assembles as a beta subunit with a voltage-gated potassium channel complex of pore-forming alpha subunits. Modulates the gating kinetics and enhances stability of the channel complex. Assembled with KCNB1 modulates the gating characteristics of the delayed rectifier voltage-dependent potassium channel KCNB1. Associated with KCNC4/Kv3.4 is proposed to form the subthreshold voltage-gated potassium channel in skeletal muscle and to establish the resting membrane potential (RMP) in muscle cells. Associated with KCNQ1/KCLQT1 may form the intestinal cAMP-stimulated potassium channel involved in chloride secretion that produces a current with nearly instantaneous activation with a linear current-voltage relationship.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 6. All seven variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG200339 | Kcne3 (tGFP-tagged) - Mouse potassium voltage-gated channel, Isk-related subfamily, gene 3 (Kcne3) |
CNY 2,850.00 |
|
MG222383 | Kcne3 (tGFP-tagged) - Mouse potassium voltage-gated channel Isk-related subfamily gene 3 (Kcne3) transcript variant 2, (10ug) |
CNY 2,850.00 |
|
MR222383 | Kcne3 (Myc-DDK-tagged) - Mouse potassium voltage-gated channel, Isk-related subfamily, gene 3 (Kcne3), transcript variant 2 |
CNY 1,200.00 |
|
MR222383L3 | Lenti ORF clone of Kcne3 (Myc-DDK-tagged) - Mouse potassium voltage-gated channel, Isk-related subfamily, gene 3 (Kcne3), transcript variant 2 |
CNY 4,750.00 |
|
MR222383L4 | Lenti ORF clone of Kcne3 (mGFP-tagged) - Mouse potassium voltage-gated channel, Isk-related subfamily, gene 3 (Kcne3), transcript variant 2 |
CNY 4,750.00 |