United States
Germany
Japan
United Kingdom
China
Ube2k (NM_016786) Mouse Untagged Clone
CAT＃: MC200177
Ube2k (untagged) - Mouse ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) (Ube2k), (10ug)
CNY 2,400.00
Product images
Specifications
| Product Data | |
| Type | Mouse Untagged Clone |
| Tag | Tag Free |
| Synonyms | AW492011; D5Ertd601e; E2-25k; HIP-2; Hip2; Hypg; Lig |
| Vector | PCMV6-Kan/Neo |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>BC002013 sequence for NM_016786
GAGGTGGCAGCGGTGGCGGTGGTCGTAGCGGTGGCGGAGGAGGCGGGTACGAATCAGCTGCGGGCAGAGA CATGGCCAACATCGCGGTGCAGCGAATCAAGCGGGAGTTCAAGGAGGTGCTGAAGAGCGAGGAGACGAGC AAAAATCAAATTAAAGTAGATCTTGTAGATGAGAATTTTACAGAATTAAGAGGAGAAATAGCAGGACCTC CAGACACACCGTATGAAGGTGGAAGATATCAACTAGAGATAAAAATACCAGAAACATATCCATTTAACCC CCCTAAGGTCCGGTTTATCACTAAAATATGGCACCCTAATATTAGTTCCGTCACAGGGGCTATTTGTTTG GATATCCTGAAAGATCAATGGGCAGCAGCAATGACTCTGCGCACGGTATTATTGTCATTGCAAGCGCTGT TGGCGGCTGCAGAACCAGATGACCCCCAAGATGCAGTAGTAGCGAATCAGTACAAACAGAATCCTGAAAT GTTCAAGCAGACAGCTCGACTTTGGGCACACGTGTACGCTGGAGCACCAGTTTCTAGTCCAGAATACACC AAAAAAATAGAAAACCTCTGTGCTATGGGTTTTGATAGGAACGCAGTAATAGTGGCCTTGTCTTCAAAAT CATGGGATGTAGAGACTGCAACAGAACTGCTTCTGAGTAACTGAGGCACAGGAGCTGCGCCAGCATCGCT CTCGCCTCTTGAGGAGCATCAACACCTGTTATTTTTAGGATTCTGCATAAAGTTCTTTTAAACTGGCATT CTTGCCTAATGATGTTACCTAGGCACCATTGGAGACTGCAAAAAAAAAAAAATTCCCTGCTCTGTAAATA AAGCTAATTAAACGTCTGTGTAAATTTAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | RsrII-NotI |
| ACCN | NM_016786 |
| Insert Size | 603 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | BC002013, AAH02013 |
| RefSeq Size | 894 bp |
| RefSeq ORF | 603 bp |
| Locus ID | 53323 |
| UniProt ID | P61087 |
| Gene Summary | Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In vitro, in the presence or in the absence of BRCA1-BARD1 E3 ubiquitin-protein ligase complex, catalyzes the synthesis of 'Lys-48'-linked polyubiquitin chains. Does not transfer ubiquitin directly to but elongates monoubiquitinated substrate protein. Mediates the selective degradation of short-lived and abnormal proteins, such as the endoplasmic reticulum-associated degradation (ERAD) of misfolded lumenal proteins. Ubiquitinates huntingtin. May mediate foam cell formation by the suppression of apoptosis of lipid-bearing macrophages through ubiquitination and subsequence degradation of p53/TP53. Proposed to be involved in ubiquitination and proteolytic processing of NF-kappa-B; in vitro supports ubiquitination of NFKB1. Involved in stabilization of CASP12 during ER stress-mediated amyloid-beta neurotoxicity probably by inhibiting proteasome activity; in vitro ubiquitinates CASP12.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| MG202030 | Ube2k (tGFP-tagged) - Mouse huntingtin interacting protein 2 (Hip2) |
CNY 2,850.00 |
|
| MR202030 | Ube2k (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) (Ube2k) |
CNY 2,400.00 |
|
| MR202030L3 | Lenti ORF clone of Ube2k (Myc-DDK-tagged) - Mouse ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) (Ube2k) |
CNY 4,750.00 |
|
| MR202030L4 | Lenti ORF clone of Ube2k (mGFP-tagged) - Mouse ubiquitin-conjugating enzyme E2K (UBC1 homolog, yeast) (Ube2k) |
CNY 4,750.00 |
