Cdkn1a (NM_007669) Mouse Untagged Clone

CAT#: MC200171

Cdkn1a (untagged) - Mouse cyclin-dependent kinase inhibitor 1A (P21) (Cdkn1a), transcript variant 1, (10ug)



  "NM_007669" in other vectors (5)

CN¥ 1,200.00

CN¥ 2,000.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
CDKN1A Rabbit polyclonal Antibody
    • 100 ul

CN¥ 1,999.00
CN¥ 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Mouse Untagged Clone
Tag Tag Free
Synonyms CAP; CAP20; CDK; CDKI; Cdkn; Cdkn1; CI; CIP1; mda; mda6; P2; P21; p21C; p21Cip1; p21W; p21WAF; SD; SDI1; Waf; Waf1
Vector PCMV6-Kan/Neo
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>BC002043 sequence for NM_007669
TGGAGTCAGGCGCAGATCCACAGCGATATCCAGACATTCAGAGCCACAGGCACCATGTCCAATCCTGGTG ATGTCCGACCTGTTCCGCACAGGAGCAAAGTGTGCCGTTGTCTCTTCGGTCCCGTGGACAGTGAGCAGTT GCGCCGTGATTGCGATGCGCTCATGGCGGGCTGTCTCCAGGAGGCCCGAGAACGGTGGAACTTTGACTTC GTCACGGAGACGCCGCTGGAGGGCAACTTCGTCTGGGAGCGCGTTCGGAGCCTAGGGCTGCCCAAGGTCT ACCTGAGCCCTGGGTCCCGCAGCCGTGACGACCTGGGAGGGGACAAGAGGCCCAGTACTTCCTCTGCCCT GCTGCAGGGGCCAGCTCCGGAGGACCACGTGGCCTTGTCGCTGTCTTGCACTCTGGTGTCTGAGCGGCCT GAAGATTCCCCGGGTGGGCCCGGAACATCTCAGGGCCGAAAACGGAGGCAGACCAGCCTGACAGATTTCT ATCACTCCAAGCGCAGATTGGTCTTCTGCAAGAGAAAACCCTGAAGTGCCCACGGGAGCCCCGCCCTCTT CTGCTGTGGGTCAGGAGGCCTCTTCCCCATCTTCGGCCTTAGCCCTCACTCTGTGTGTCTTAATTATTAT TTGTGTTTTAATTTAAACGTCTCCTGTATATACGCTGCCTGCCCTCTCCCAGTCTCCAAACTTAAAGTTA TTTAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites RsrII-NotI     
ACCN NM_007669
Insert Size 480 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC002043, AAH02043
RefSeq Size 727 bp
RefSeq ORF 480 bp
Locus ID 12575
UniProt ID P39689
Gene Summary This gene encodes a potent cyclin-dependent kinase inhibitor. The encoded protein binds to and inhibits the activity of cyclin-cyclin-dependent kinase2 or cyclin-dependent kinase4 complexes, and thus functions as a regulator of cell cycle progression at the G1 pahse. The expression of this gene is tightly controlled by the tumor suppressor protein p53, through which this protein mediates the p53-dependent cell cycle G1 phase arrest in response to a variety of stress stimuli. This protein can interact with proliferating cell nuclear antigen, a DNA polymerase accessory factor, and plays a regulatory role in S phase DNA replication and DNA damage repair. This protein was reported to be specifically cleaved by CASP3-like caspases, which thus leads to a dramatic activation of cyclin-dependent kinase2, and may be instrumental in the execution of apoptosis following caspase activation. Mice that lack this gene have the ability to regenerate damaged or missing tissue. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (1) represents the predominant transcript. Variants 1 and 2 both encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...