Abhd12 (NM_024465) Mouse Untagged Clone
CAT#: MC200091
Abhd12 (untagged) - Mouse abhydrolase domain containing 12 (Abhd12), (10ug)
CN¥ 2,400.00
Product images

Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 1500011G07Rik; 6330583M11Rik; AI431047; AW547313 |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC002263 sequence for NM_024465
GCCTATTGACGGTACCCGAGAGTGTCTGCTGCCCTGTGTGGTAAAGCATCATCCTGACAGGTGCTGAGTT CCCTTGGCTACCACGTGGTCACCTTTGACTACAGAGGTTGGGGTGACTCAGTAGGAACACCATCGGAGCG AGGCATGACGTATGACGCACTCCATGTTTTTGACTGGATCAAAGCAAGAAGTGGTGATAATCCTGTGTAT ATTTGGGGCCATTCACTGGGCACCGGAGTGGCAACAAATCTGGTACGGCGCCTCTGTGAGCGAGAGACGC CACCAGATGCCCTTATATTGGAGTCTCCATTCACAAATATTCGTGAAGAAGCAAAGAGTCATCCATTTTC AGTGATATACCGATACTTCCCTGGCTTTGACTGGTTCTTCCTCGACCCCATTACAAGCAGTGGAATTAAA TTTGCAAATGACGAAAATATGAAGCACATCTCCTGCCCTCTGCTCATCTTGCATGCCGAGGATGATCCAG TTGTGCCCTTTCATCTCGGTAGAAAGCTATACAACATTGCTGCGCCATCTCGAAGTTTCCGAGACTTCAA AGTCCAGTTTATCCCCTTTCACTCAGACCTTGGCTACAGACATAAATACATCTACAAGAGCCCAGAGCTT CCAAGGATACTGAGGGAATTCCTAGGGAAGTCGGAACCGGAACGCCAGCACTGAGACCGGCCCATGAAGG AGCATGAAGACCCACCTTCCTTCCTTCTCCCCTGGACAGCAGTCTGGCACCCAGAAGCCCAGAGTGCCAC CACCTGTGGTGCTCAGGAGCCCAGTGCACACCTAGAAAGAGGACTCAGACACAGCGGGCAGAGGCTCCTG ATGGATCTGTGAGGAAAACCCGGTGGCAGGCAGGTGGCCCCCCCAGCCCTCTGGTGACCACTGTATCTGA GCTCTTTTTGGGAAGGCTTATAGACAGCAGGTGGACCCCATATGCTGGGCATAGGGAGCCTGGGAAGGGC TCAGGAGCTCAGGACCACTCCAGGCTCTCTGGCACCATTGCTTAAGATTCAGGAAAATGGTTCTTTCTGC CCTTCCTAGCGTTTACAGAACAGACTCCAAGTGGTTCAGTTTGTCTCCTACAGCTCATTTACCTGCTTGC CTTCCTCAGCTGTCCCTGCCTCTCCTGGCATCTGATTACCCACAGTAAGGGGCACCTGGATCTGCACTTC TTCCATTCTGCCCACCTGTCTGTCACCTAACCTGGCCGTAGACTGAGCATTTATTTAAGAATAAAATCTC GGTGGTGGTCTATTTATTGTTTTCTCTACAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_024465 |
Insert Size | 540 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC002263, AAH02263 |
RefSeq Size | 1304 bp |
RefSeq ORF | 540 bp |
Locus ID | 76192 |
UniProt ID | Q99LR1 |
Gene Summary | Lysophosphatidylserine (LPS) lipase that mediates the hydrolysis of lysophosphatidylserine, a class of signaling lipids that regulates immunological and neurological processes (PubMed:23297193, PubMed:25580854, PubMed:30420694). Represents a major lysophosphatidylserine lipase in the brain, thereby playing a key role in the central nervous system (PubMed:23297193). Also able to hydrolyze oxidized phosphatidylserine; oxidized phosphatidylserine is produced in response to severe inflammatory stress and constitutes a proapoptotic 'eat me' signal (PubMed:30643283). Also has monoacylglycerol (MAG) lipase activity: hydrolyzes 2-arachidonoylglycerol (2-AG), thereby acting as a regulator of endocannabinoid signaling pathways (PubMed:18096503). Has a strong preference for very-long-chain lipid substrates; substrate specificity is likely due to improved catalysis and not improved substrate binding (PubMed:30237167).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201590 | Abhd12 (tGFP-tagged) - Mouse abhydrolase domain containing 12 (Abhd12) |
CN¥ 2,850.00 |
|
MR201590 | Abhd12 (Myc-DDK-tagged) - Mouse abhydrolase domain containing 12 (Abhd12) |
CN¥ 2,400.00 |
|
MR201590L3 | Lenti ORF clone of Abhd12 (Myc-DDK-tagged) - Mouse abhydrolase domain containing 12 (Abhd12) |
CN¥ 4,750.00 |
|
MR201590L4 | Lenti ORF clone of Abhd12 (mGFP-tagged) - Mouse abhydrolase domain containing 12 (Abhd12) |
CN¥ 4,750.00 |