Emg1 (NM_013536) Mouse Untagged Clone
CAT#: MC200074
Emg1 (untagged) - Mouse EMG1 nucleolar protein homolog (S. cerevisiae) (Emg1), (10ug)
CN¥ 2,400.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | C2f; Grcc2f |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC002004 sequence for NM_013536
CGGACGTGAAGTTCTAACTTAAGGACTTCGGTGCAACTTCCGGTCTGCCTACAAGATGTCTGCGGCCAGT GGTGGCTTCCAACCTCGTGAGCGGCGATTTTCAGTGCAGGAGCAGGACTGGGAGACTACGCCGCCTAAGA AGCTCCGGCTTGGGGCAGGAAGCAAGTGCGGAGGCCGGAGGCTCATTGTGGTGCTGGAAGGGGCCAGTCT GGAGACAGTCAAGGTAGGGAAAACTTACGAGCTACTCAACTGTGACAGGCACAAGTCCATGTTGTTGAAG AATGGACGGGACCCAGGGGAAGTCAGACCAGACATCACCCACCAGAGCCTGCTGATGCTTATGGACAGCC CCCTGAACCGAGCTGGCTTGCTACAGGTTTACATCCACACACAGAAGAACGTGCTGATTGAAGTGAACCC CCAGACTCGAATTCCTAGAACCTTTGACCGATTTTGTGGCCTCATGGTTCAGCTTTTACACAAACTGAGC GTCCGAGCAGCCGACGGCCCTCAGAAGCTATTGAAGGTAATTAAGAATCCAGTGTCCGACCACTTCCCAG TTGGCTGTATGAAAATTGGCACTTCCTTTTCTGTTGAAGACATCAGTGACATTCGAGAGTTGGTGCCCAG TAGTGACCCAGTTGTGTTTGTGGTGGGGGCCTTTGCCCATGGCAAGGTCAGTGTGGAGTACACAGAAAAG ATGGTGTCCATCAGCAACTATCCACTCTCTGCTGCGCTTACCTGTGCTAAAGTCACCACAGCTTTTGAAG AAGTATGGGGTGTCATTTGAGCCCAGCAGGGCCTGGTTCTCAGACAGGAAGGACTCTTGGCAGTTTGTCT TTTGGCTCCTAAGATCTGCTGGAAGATAATCTTCTGTACCAAGACTGCAGAGTGGGGAGACAACACTGTA TAGTTGTTTTTTGTTTTTCCTATAAAGAGTTTTATTTCGTTTTTAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_013536 |
Insert Size | 735 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | BC002004, AAH02004 |
RefSeq Size | 1019 bp |
RefSeq ORF | 735 bp |
Locus ID | 14791 |
UniProt ID | O35130 |
Gene Summary | S-adenosyl-L-methionine-dependent pseudouridine N(1)-methyltransferase that methylates pseudouridine at position 1248 (Psi1248) in 18S rRNA. Involved the biosynthesis of the hypermodified N1-methyl-N3-(3-amino-3-carboxypropyl) pseudouridine (m1acp3-Psi) conserved in eukaryotic 18S rRNA. Is not able to methylate uridine at this position. Has also an essential role in 40S ribosomal subunit biogenesis independent on its methyltransferase activity, facilitating the incorporation of ribosomal protein S19 during the formation of pre-ribosomes.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG203055 | Emg1 (tGFP-tagged) - Mouse EMG1 nucleolar protein homolog (S. cerevisiae) (Emg1) |
CN¥ 2,850.00 |
|
MR203055 | Emg1 (Myc-DDK-tagged) - Mouse EMG1 nucleolar protein homolog (S. cerevisiae) (Emg1) |
CN¥ 2,400.00 |
|
MR203055L3 | Lenti ORF clone of Emg1 (Myc-DDK-tagged) - Mouse EMG1 nucleolar protein homolog (S. cerevisiae) (Emg1) |
CN¥ 4,750.00 |
|
MR203055L4 | Lenti ORF clone of Emg1 (mGFP-tagged) - Mouse EMG1 nucleolar protein homolog (S. cerevisiae) (Emg1) |
CN¥ 4,750.00 |