Pigx (NM_024464) Mouse Untagged Clone
CAT#: MC200047
Pigx (untagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class X (Pigx), transcript variant 1, (10ug)
CNY 1,200.00
CNY 2,000.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Mouse Untagged Clone |
Tag | Tag Free |
Synonyms | 2010319C14Rik; PIG-X |
Vector | PCMV6-Kan/Neo |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>BC002202 sequence for NM_024464
GTTCATACCTGCAGTTTTTTTAACACTTGGAAGTAAGAGGCGGGAGAATTGCAGGTTAAAGGCCAACCTG AGCTGCAGAGTAAATTTTAATCCAGCCTTAGCTAACCGGCAGTGATGCTATCAGAAAGTTTTAATATAGA AGCCCCCAACTACTTGTCCAATGAATCTGCAGTCCTCATTTATGCCCGGCAGGATGCACAGTGCATCGAC TGCTTCCAGGCCTTTTTACCTGTGCACTATCGCTATCACCGGCCACATAAGAAAGATGGAGACACCCTCA TTGTGGTCAACAACCCCGACTTACTGATGTACTGTGACCAAGAGTTTCCAATTTTGAAATGCTGGGCTCA GTCAGAAGTAGCAGCTCCTTGTGCTTTGAAGAGTGAGGAGATCTGCCAGTGGAAAAGCATGCAGTACAAA TCAATACTTAAGAATTTGACAGTGCAGGTTCCAGTGGGACTGACTATACATACCTCTTTAGTGTGTTCTG TGACGCTGCTCATTACGATTCTGTGTTCTACTTTGATCCTTTTAGCTGTTTTCAAATATGGCCACTTTTC CCTGTAAGTTTTGTACAGCTAAGTGTTTTCTATGAACCTAATAAATGAGACAAGAGTGCTCTTTTCAGAA AAAAAAAAAAAAAA |
Restriction Sites | RsrII-NotI |
ACCN | NM_024464 |
Insert Size | 453 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | BC002202, AAH02202 |
RefSeq Size | 644 bp |
RefSeq ORF | 453 bp |
Locus ID | 72084 |
UniProt ID | Q99LV7 |
Gene Summary | This gene encodes a type I transmembrane protein in the endoplasmic reticulum (ER). The protein is an essential component of glycosylphosphatidylinositol-mannosyltransferase I, which transfers the first of the four mannoses in the GPI-anchor precursors during GPI-anchor biosynthesis. Studies in rat indicate that the protein is translated from a non-AUG translation initiation site. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
MG201059 | Pigx (tGFP-tagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class X (Pigx) |
CNY 2,850.00 |
|
MR201059 | Pigx (Myc-DDK-tagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class X (Pigx), transcript variant 1 |
CNY 1,200.00 |
|
MR201059L3 | Lenti ORF clone of Pigx (Myc-DDK-tagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class X (Pigx), transcript variant 1 |
CNY 4,750.00 |
|
MR201059L4 | Lenti ORF clone of Pigx (mGFP-tagged) - Mouse phosphatidylinositol glycan anchor biosynthesis, class X (Pigx), transcript variant 1 |
CNY 4,750.00 |