CD64 (FCGR1A) (NM_000566) Human 3' UTR Clone

CAT#: SC212369

3' UTR clone of Fc fragment of IgG high affinity Ia receptor (CD64) (FCGR1A) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name CD64 (FCGR1A) (NM_000566) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD64; CD64A; FCRI; IGFR1
ACCN NM_000566
Insert Size 188 bp
Sequence Data
>SC212369 3’UTR clone of NM_000566
The sequence shown below is from the reference sequence of NM_000566. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACCGGAAGGAGCCCCAGGGGGCCACGTAGCAGCGGCTCAGTGGGTGGCCATCGATCTGGACCGTCCCC
TGCCCACTTGCTCCCCGTGAGCACTGCGTACAAACATCCAAAAGTTCAACAACACCAGAACTGTGTGTC
TCATGGTATGTAACTCTTAAAGCAAATAAATGAACTGACTTCAACTGGGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000566.4
Synonyms CD64; CD64A; FCRI; IGFR1
Summary This gene encodes a protein that plays an important role in the immune response. This protein is a high-affinity Fc-gamma receptor. The gene is one of three related gene family members located on chromosome 1. [provided by RefSeq, Jul 2008]
Locus ID 2209
MW 7.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...