ACAT1 (NM_000019) Human 3' UTR Clone

CAT#: SC209895

3' UTR clone of acetyl-Coenzyme A acetyltransferase 1 (ACAT1) nuclear gene encoding mitochondrial protein for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ACAT1 (NM_000019) Human 3' UTR Clone
Vector pMirTarget
Synonyms ACAT; MAT; T2; THIL
ACCN NM_000019
Insert Size 243 bp
Sequence Data
>SC209895 3’UTR clone of NM_000019
The sequence shown below is from the reference sequence of NM_000019. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GCTTCTGCCATGCTAATTCAGAAGCTGTAGACAACCTCTGCTATTTAAGGAGACAACCCTATGTGACCA
GAAGGCCTGCTGTAATCAGTGTGACTACTGTGGGTCAGCTTATATTCAGATAAGCTGTTTCATTTTTTA
TTATTTTCTATGTTAACTTTTAAAAATCAAAATGATGAAATCCCAAAACATTTTGAAATTAAAAATAAA
TTTCTTCTTCTGCTTTTTTCTTGGTAACCTTGAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000019.4
Synonyms ACAT; MAT; T2; THIL
Summary This gene encodes a mitochondrially localized enzyme that catalyzes the reversible formation of acetoacetyl-CoA from two molecules of acetyl-CoA. Defects in this gene are associated with 3-ketothiolase deficiency, an inborn error of isoleucine catabolism characterized by urinary excretion of 2-methyl-3-hydroxybutyric acid, 2-methylacetoacetic acid, tiglylglycine, and butanone. [provided by RefSeq, Feb 2009]
Locus ID 38
MW 9.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...