PIP5K3 (PIKFYVE) (NM_152671) Human 3' UTR Clone

CAT#: SC208150

3' UTR clone of phosphoinositide kinase FYVE finger containing (PIKFYVE) transcript variant 3 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PIP5K3 (PIKFYVE) (NM_152671) Human 3' UTR Clone
Vector pMirTarget
Synonyms CFD; FAB1; HEL37; PIP5K; PIP5K3; ZFYVE29
ACCN NM_152671
Insert Size 555 bp
Sequence Data
>SC208150 3’UTR clone of NM_152671
The sequence shown below is from the reference sequence of NM_152671. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CACCCTGCTGACCAAAAAGGTAGGAGGTAGTCACCATCTGGAATCCAAACACAGGCTGGACAGCTGGGC
CATAGGATCTCATGCCAGCCTGTCCTTCTGGCTTCCTCTGTCCCACGTGGCTGAGGGTATTTGGTGTGG
GTTTTGTTCTACCCTTTCTCATTTCTCCCACACCTCCTCCCCATACCTTTTTTGGTTGATTCCTTTTAT
TTCTTGTTTTCTCCCTCAGCACCACCATGCCCAGTGTAAAGCTTGTAGTCTTTAAAAGGAACTACATCT
GACTGCTCTTCCCATAATGTGCAACTTCCAAGGTGGCATTTCTTTGCATTTATAACATGGATGTTCTGC
TCTATTCTTTTCTCTTTCTTCATTTAACATTTTAAAGCCTATTTGCCTTTGCCGTTACCCAGTAACATA
ATATTTCACTAAACCCATTAAGATGCTTGAACTAGATTGGGGGAAAATCATTCACACATTCCAAAATAT
CTCCATAATAATTCATAATGCTTATTATGTATATTCTATATTTATTAAAACAATTTCTTCTCTAATGTA
AAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_152671.4
Synonyms CFD; FAB1; HEL37; PIP5K; PIP5K3; ZFYVE29
Summary Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
Locus ID 200576
MW 21.2
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...