SMN1 (NM_022874) Human 3' UTR Clone

CAT#: SC207856

3' UTR clone of survival of motor neuron 1 telomeric (SMN1) transcript variant b for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name SMN1 (NM_022874) Human 3' UTR Clone
Vector pMirTarget
Synonyms BCD541; GEMIN1; SMA; SMA1; SMA2; SMA3; SMA4; SMA@; SMN; SMNT; T-BCD541; TDRD16A
ACCN NM_022874
Insert Size 623 bp
Sequence Data
>SC207856 3’UTR clone of NM_022874
The sequence shown below is from the reference sequence of NM_022874. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GAAGGAAGGTGCTCACATTCCTTAAATTAAGGAGAAATGCTGGCATAGAGCAGCACTAAATGACACCAC
TAAAGAAACGATCAGACAGATCTGGAATGTGAAGCGTTATAGAAGATAACTGGCCTCATTTCTTCAAAA
TATCAAGTGTTGGGAAAGAAAAAAGGAAGTGGAATGGGTAACTCTTCTTGATTAAAAGTTATGTAATAA
CCAAATGCAATGTGAAATATTTTACTGGACTCTATTTTGAAAAACCATCTGTAAAAGACTGGGGTGGGG
GTGGGAGGCCAGCACGGTGGTGAGGCAGTTGAGAAAATTTGAATGTGGATTAGATTTTGAATGATATTG
GATAATTATTGGTAATTTTATGAGCTGTGAGAAGGGTGTTGTAGTTTATAAAAGACTGTCTTAATTTGC
ATACTTAAGCATTTAGGAATGAAGTGTTAGAGTGTCTTAAAATGTTTCAAATGGTTTAACAAAATGTAT
GTGAGGCGTATGTGGCAAAATGTTACAGAATCTAACTGGTGGACATGGCTGTTCATTGTACTGTTTTTT
TCTATCTTCTATATGTTTAAAAGTATATAATAAAAATATTTAATTTTTTTTTAAAAAAAAAAAAAAAAA
AA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_022874.2
Synonyms BCD541; GEMIN1; SMA; SMA1; SMA2; SMA3; SMA4; SMA@; SMN; SMNT; T-BCD541; TDRD16A
Summary This gene is part of a 500 kb inverted duplication on chromosome 5q13. This duplicated region contains at least four genes and repetitive elements which make it prone to rearrangements and deletions. The repetitiveness and complexity of the sequence have also caused difficulty in determining the organization of this genomic region. The telomeric and centromeric copies of this gene are nearly identical and encode the same protein. However, mutations in this gene, the telomeric copy, are associated with spinal muscular atrophy; mutations in the centromeric copy do not lead to disease. The centromeric copy may be a modifier of disease caused by mutation in the telomeric copy. The critical sequence difference between the two genes is a single nucleotide in exon 7, which is thought to be an exon splice enhancer. Note that the nine exons of both the telomeric and centromeric copies are designated historically as exon 1, 2a, 2b, and 3-8. It is thought that gene conversion events may involve the two genes, leading to varying copy numbers of each gene. The protein encoded by this gene localizes to both the cytoplasm and the nucleus. Within the nucleus, the protein localizes to subnuclear bodies called gems which are found near coiled bodies containing high concentrations of small ribonucleoproteins (snRNPs). This protein forms heteromeric complexes with proteins such as SIP1 and GEMIN4, and also interacts with several proteins known to be involved in the biogenesis of snRNPs, such as hnRNP U protein and the small nucleolar RNA binding protein. Multiple transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2014]
Locus ID 6606
MW 24.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...