CYP3A43 (NM_057095) Human 3' UTR Clone

CAT#: SC207363

3' UTR clone of cytochrome P450 family 3 subfamily A polypeptide 43 (CYP3A43) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CYP3A43 (NM_057095) Human 3' UTR Clone
Vector pMirTarget
ACCN NM_057095
Insert Size 122 bp
Sequence Data
>SC207363 3’UTR clone of NM_057095
The sequence shown below is from the reference sequence of NM_057095. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTAAGAGATGGGATTACAAGTGGACCCTGACTTTCCCTAAGGACTTCCACTTTGTTCAAGAAAGCTGTA
TCCCAGAACACTAGACACTTCAAATTGTTTTGTGAATAAAACTCAGAAATGAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_057095.3
Summary This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. The encoded protein has a low level of testosterone hydroxylase activity, and may play a role in aging mechanisms and cancer progression. This gene is part of a cluster of cytochrome P450 genes on chromosome 7q21.1. Alternate splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2013]
Locus ID 64816
MW 4.6
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...