CD13 (ANPEP) (NM_001150) Human 3' UTR Clone

CAT#: SC207299

3' UTR clone of alanyl (membrane) aminopeptidase (ANPEP) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CD13 (ANPEP) (NM_001150) Human 3' UTR Clone
Vector pMirTarget
Synonyms APN; CD13; GP150; LAP1; P150; PEPN
ACCN NM_001150
Insert Size 484 bp
Sequence Data
>SC207299 3’UTR clone of NM_001150
The sequence shown below is from the reference sequence of NM_001150. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CTCCAGTGGTTCACAGAAAACAGCAAATAGTCCCCAGCCCTTGAAGTCACCCGGCCCCCATGCAAGGTG
CCCACATGTGTCCATCCCAGCGGCTGGTGCAGGGCCTCCATTCCTGGAGCCCGAGGCACCAGTGTCCTC
CCCTCAAGGACAAAGTCTCCAGCCCACGTTCTCTCTGCCTGTGAGCCAGTCTAGTTCCTGATGACCCAG
GCTGCCTGAGCACCTCCCAGCCCCTGCCCCTCATGCCAACCCCGCCCTAGGCCTGGCATGGCACCTGTC
GCCCAGTGCCCTGGGGCTGATCTCAGGGAAGCCCAGCTCCAGGGCCAGATGAGCAGAAGCTCTCGATGG
ACAATGAACGGCCTTGCTGGGGGCCGCCCTGTACCCTCTTTCACCTTTCCCTAAAGACCCTAAATCTGA
GGAATCAACAGGGCAGCAGATCTGTATATTTTTTTCTAAGAGAAAATGTAAATAAAGGATTTCTAGATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001150.3
Synonyms APN; CD13; GP150; LAP1; P150; PEPN
Summary Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. This membrane-bound zinc metalloprotease is known to serve as a receptor for the HCoV-229E alphacoronavirus as well as other non-human coronaviruses. This gene has also been shown to promote angiogenesis, tumor growth, and metastasis and defects in this gene are associated with various types of leukemia and lymphoma. [provided by RefSeq, Apr 2020]
Locus ID 290
MW 17.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...