CCN5 (NM_003881) Human 3' UTR Clone

CAT#: SC207149

3' UTR clone of WNT1 inducible signaling pathway protein 2 (WISP2) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CCN5 (NM_003881) Human 3' UTR Clone
Vector pMirTarget
Synonyms CT58; CTGF-L; WISP2
ACCN NM_003881
Insert Size 534 bp
Sequence Data
>SC207149 3’UTR clone of NM_003881
The sequence shown below is from the reference sequence of NM_003881. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGTCGCAGTCCACAAAACAGTGCCTTCTAGAGCCGGGCTGGGAATGGGGACACGGTGTCCACCATCCCC
AGCTGGTGGCCCTGTGCCTGGGCCCTGGGCTGATGGAAGATGGTCCGTGCCCAGGCCCTTGGCTGCAGG
CAACACTTTAGCTTGGGTCCACCATGCAGAACACCAATATTAACACGCTGCCTGGTCTGTCTGGATCCC
GAGGTATGGCAGAGGTGCAAGACCTAGTCCCCTTTCCTCTAACTCACTGCCTAGGAGGCTGGCCAAGGT
GTCCAGGGTCCTCTAGCCCACTCCCTGCCTACACACACAGCCTATATCAAACATGCACACGGGCGAGCT
TTCTCTCCGACTTCCCCTGGGCAAGAGATGGGACAAGCAGTCCCTTAATATTGAGGCTGCAGCAGGTGC
TGGGCTGGACTGGCCATTTTTCTGGGGGTAGGATGAAGAGAAGGCACACAGAGATTCTGGATCTCCTGC
TGCCTTTTCTGGAGTTTGTAAAATTGTTCCTGAATACAAGCCTATGCGTGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_003881.4
Synonyms CT58; CTGF-L; WISP2
Summary This gene encodes a member of the WNT1 inducible signaling pathway (WISP) protein subfamily, which belongs to the connective tissue growth factor (CTGF) family. WNT1 is a member of a family of cysteine-rich, glycosylated signaling proteins that mediate diverse developmental processes. The CTGF family members are characterized by four conserved cysteine-rich domains: insulin-like growth factor-binding domain, von Willebrand factor type C module, thrombospondin domain and C-terminal cystine knot-like (CT) domain. The encoded protein lacks the CT domain which is implicated in dimerization and heparin binding. It is 72% identical to the mouse protein at the amino acid level. This gene may be downstream in the WNT1 signaling pathway that is relevant to malignant transformation. Its expression in colon tumors is reduced while the other two WISP members are overexpressed in colon tumors. It is expressed at high levels in bone tissue, and may play an important role in modulating bone turnover. [provided by RefSeq, Jul 2008]
Locus ID 8839
MW 19.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...