Corticotropin Releasing Factor (CRH) (NM_000756) Human 3' UTR Clone

CAT#: SC206875

3' UTR clone of corticotropin releasing hormone (CRH) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Corticotropin Releasing Factor (CRH) (NM_000756) Human 3' UTR Clone
Vector pMirTarget
Synonyms CRF; CRH1
ACCN NM_000756
Insert Size 541 bp
Sequence Data
>SC206875 3’UTR clone of NM_000756
The sequence shown below is from the reference sequence of NM_000756. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGGAAACTCATGGAGATTATTGGGAAATAAAACGGTGCGTTTGGCCAAAAAGAATCTGCATTTAGCACA
AAAAAAATTTAAAAAAATACAGTATTCTGTACCATAGCGCTGCTCTTATGCCATTTGTTTATTTTTATA
TAGCTTGAAACATAGAGGGAGAGAGGGAGAGAGCCTATACCCCTTACTTAGCATGCACAAAGTGTATTC
ACGTGCAGCAGCAACACAATGTTATTCGTTTTGTCTACGTTTAGTTTCCGTTTCCAGGTGTTTATAGTG
GTGTTTTAAAGAGAATGTAGACCTGTGAGAAAACGTTTTGTTTGAAAAAGCAGACAGAAGTCACTCAAT
TGTTTTTGTTGTGGTCTGAGCCAAAGAGAATGCCATTCTCTTGGGTGGGTAAGACTAAATCTGTAAGCT
CTTTGAAACAACTTTCTCTTGTAAACGTTTCAGTAATAAAACATCTTTCCAGTCCTTGGTCAGTTTGGT
TGTGTAAGAGAATGTTGAATACTTATATTTTTAATAAAAGTTGCAAAGGTAATCATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000756.4
Synonyms CRF; CRH1
Summary This gene encodes a member of the corticotropin-releasing factor family. The encoded preproprotein is proteolytically processed to generate the mature neuropeptide hormone. In response to stress, this hormone is secreted by the paraventricular nucleus (PVN) of the hypothalamus, binds to corticotropin releasing hormone receptors and stimulates the release of adrenocorticotropic hormone from the pituitary gland. Marked reduction in this protein has been observed in association with Alzheimer's disease. Autosomal recessive hypothalamic corticotropin deficiency has multiple and potentially fatal metabolic consequences including hypoglycemia and hepatitis. In addition to production in the hypothalamus, this protein is also synthesized in peripheral tissues, such as T lymphocytes, and is highly expressed in the placenta. In the placenta it is a marker that determines the length of gestation and the timing of parturition and delivery. A rapid increase in circulating levels of the hormone occurs at the onset of parturition, suggesting that, in addition to its metabolic functions, this protein may act as a trigger for parturition. [provided by RefSeq, Nov 2015]
Locus ID 1392
MW 20.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...