ISCU (NM_213595) Human 3' UTR Clone

CAT#: SC206548

3' UTR clone of iron-sulfur cluster scaffold homolog (E. coli) (ISCU) nuclear gene encoding mitochondrial protein transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name ISCU (NM_213595) Human 3' UTR Clone
Vector pMirTarget
Synonyms 2310020H20Rik; HML; hnifU; ISU2; NIFU; NIFUN
ACCN NM_213595
Insert Size 482 bp
Sequence Data
>SC206548 3’UTR clone of NM_213595
The sequence shown below is from the reference sequence of NM_213595. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCAAAAAAGGAGAGGCAGAGAAGAAATGAGCCCTCCCTCGGCGAAGCCTCCAGCAGGCCACACCAGCT
GTTTCCCACCTGCTGTGCAGTCACCTTAGATGTTCAGAAGCCGCTTCCTCTCCACTGAAGAGCTATGAG
ATACGCACAATACTTGCTGTTCACGTTATGACTCTCATGCAAGCAAAATACACAGTTTCATTGTTCTGA
ATCCTGTGGTTTCTTTCAGCCCACTTTTATCGCCTTAACCTAGTTAATGTATATTTTGAATTGTGTGTA
TGACCTCAGAACTGAAATTGATAATGAAGTTGCAAGTTTTGATAGCCCGTGAAGTGCATAAGTATCTAA
TTTTACCTGAATTGATTTGGGGGGAAATTACCAGTAGAATGCCTTGGTCTGAATATTTGATAGAACCAA
TTGTTGTACATAAAACAGATTGCGCATATATATATATGTATAAAAAATAATAAAATAATGGAAGATGA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_213595.4
Synonyms 2310020H20Rik; HML; hnifU; ISU2; NIFU; NIFUN
Summary This gene encodes a component of the iron-sulfur (Fe-S) cluster scaffold. Fe-S clusters are cofactors that play a role in the function of a diverse set of enzymes, including those that regulate metabolism, iron homeostasis, and oxidative stress response. Alternative splicing results in transcript variants encoding different protein isoforms that localize either to the cytosol or to the mitochondrion. Mutations in this gene have been found in patients with hereditary myopathy with lactic acidosis. A disease-associated mutation in an intron may activate a cryptic splice site, resulting in the production of a splice variant encoding a putatively non-functional protein. A pseudogene of this gene is present on chromosome 1. [provided by RefSeq, Feb 2016]
Locus ID 23479
MW 18.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...