Leptin Receptor (LEPR) (NM_002303) Human 3' UTR Clone

CAT#: SC206473

3' UTR clone of leptin receptor (LEPR) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Leptin Receptor (LEPR) (NM_002303) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD295; LEP-R; LEPRD; OB-R; OBR
ACCN NM_002303
Insert Size 484 bp
Sequence Data
>SC206473 3' UTR clone of NM_002303
The sequence shown below is from the reference sequence of NM_002303. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

GGAAAACAAGATGTGTGACCTAACTGTGTAATTTCACTGAAGAAACCTTCAGATTTGTGTTATAATGGGT
AATATAAAGTGTAATAGATTATAGTTGTGGGTGGGAGAGAGAAAAGAAACCAGAGTCAAATTTGAAAATA
ATTGTTCCAAATGAATGTTGTCTGTTTGTTCTCTCTTAGTAACATAGACAAAAAATTTGAGAAAGCCTTC
ATAAGCCTACCAATGTAGACACGCTCTTCTATTTTATTCCCAAGCTCTAGTGGGAAGGTCCCTTGTTTCC
AGCTAGAAATAAGCCCAACAGACACCATCTTTTGTGAGATGTAATTGTTTTTTCAGAGGGCGTGTTGTTT
TACCTCAAGTTTTTGTTTTGTACCAACACACACACACACACACATTCTTAACACATGTCCTTGTGTGTTT
TGAGAGTATATTATGTATTTATATTTTGTGCTATCAGACTGTAGGATTTGAAGTAGGACTTTCC

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_002303.4
Synonyms CD295; LEP-R; LEPRD; OB-R; OBR
Summary The protein encoded by this gene belongs to the gp130 family of cytokine receptors that are known to stimulate gene transcription via activation of cytosolic STAT proteins. This protein is a receptor for leptin (an adipocyte-specific hormone that regulates body weight), and is involved in the regulation of fat metabolism, as well as in a novel hematopoietic pathway that is required for normal lymphopoiesis. Mutations in this gene have been associated with obesity and pituitary dysfunction. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. It is noteworthy that this gene and LEPROT gene (GeneID:54741) share the same promoter and the first 2 exons, however, encode distinct proteins (PMID:9207021).[provided by RefSeq, Nov 2010]
Locus ID 3953
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...