BRG1 (SMARCA4) (NM_001128844) Human 3' UTR Clone

CAT#: SC206425

3' UTR clone of SWI/SNF related matrix associated actin dependent regulator of chromatin subfamily a member 4 (SMARCA4) transcript variant 2



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Cited in 1 publication.

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name BRG1 (SMARCA4) (NM_001128844) Human 3' UTR Clone
Vector pMirTarget
Synonyms BAF190; BAF190A; BRG1; CSS4; hSNF2b; MRD16; RTPS2; SNF2; SNF2-beta; SNF2L4; SNF2LB; SWI2
ACCN NM_001128844
Insert Size 487 bp
Sequence Data
>SC206425 3’UTR clone of NM_001128844
The sequence shown below is from the reference sequence of NM_001128844. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CGCTCAGGAAGTGGCAGCGAAGAAGACTGAGCCCCGACATTCCAGTCTCGACCCCGAGCCCCTCGTTCC
AGAGCTGAGATGGCATAGGCCTTAGCAGTAACGGGTAGCAGCAGATGTAGTTTCAGACTTGGAGTAAAA
CTGTATAAACAAAAGAATCTTCCATATTTATACAGCAGAGAAGCTGTAGGACTGTTTGTGACTGGCCCT
GTCCTGGCATCAGTAGCATCTGTAACAGCATTAACTGTCTTAAAGAGAGAGAGAGAGAATTCCGAATTG
GGGAACACACGATACCTGTTTTTCTTTTCCGTTGCTGGCAGTACTGTTGCGCCGCAGTTTGGAGTCACT
GTAGTTAAGTGTGGATGCATGTGCGTCACCGTCCACTCCTCCTACTGTATTTTATTGGACAGGTCAGAC
TCGCCGGGGGCCCGGCGAGGGTATGTCAGTGTCACTGGATGTCAAACAGTAATAAATTAAACCAACAAC
AAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001128844.3
Synonyms BAF190; BAF190A; BRG1; CSS4; hSNF2b; MRD16; RTPS2; SNF2; SNF2-beta; SNF2L4; SNF2LB; SWI2
Summary The protein encoded by this gene is a member of the SWI/SNF family of proteins and is similar to the brahma protein of Drosophila. Members of this family have helicase and ATPase activities and are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI, which is required for transcriptional activation of genes normally repressed by chromatin. In addition, this protein can bind BRCA1, as well as regulate the expression of the tumorigenic protein CD44. Mutations in this gene cause rhabdoid tumor predisposition syndrome type 2. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012]
Locus ID 6597
MW 17.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Citations (1)

Documents

Customer Reviews 
Loading...