MKRN1 (NM_001145125) Human 3' UTR Clone

CAT#: SC206387

3' UTR clone of makorin ring finger protein 1 (MKRN1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CN¥ 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CN¥ 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00

Specifications

Product Data
Product Name MKRN1 (NM_001145125) Human 3' UTR Clone
Vector pMirTarget
Synonyms RNF61
ACCN NM_001145125
Insert Size 463 bp
Sequence Data
>SC206387 3’UTR clone of NM_001145125
The sequence shown below is from the reference sequence of NM_001145125. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AAGCAATTTGAGAGCAAGATCATAAAGTGAGACTCCTCCCCAGTCTTCATTTGTGCTTTCTCTTTTGGG
GAAGAATTTAGTAACTTGTGCCAACTTTCAACCAGATGGACCGCATTTAAATGCATGCATTTTATCTTG
AAACTGGGATATTCTAATGGGGATTTCTTCTTTGTATTTCAGCTAGCTTCTAGGTTAGTTGGTCTATCT
ACTTTTATTTGAATGAGGAAACCCTGTGTATCAGTTAGAATCTTCGTGCTTTTTCTGAGGAGATTGTGT
TTAATGGATTATTAGCCAGTTTAGGCTCAGTGAACAAACTGATCTAGCTCTGAATGTATGTTTCCTGAC
GTTTTACATTTCCACTTTCCTATTCCATTCATTAAGCTAGCCAACAATCCACCATCCTTTAAAGATTGT
TCTCATAACTGAACAAAAACCACATAATCTAAACAGAGCAAAGCTACAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001145125.2
Synonyms RNF61
Summary This gene encodes a protein that belongs to a novel class of zinc finger proteins. The encoded protein functions as a transcriptional co-regulator, and as an E3 ubiquitin ligase that promotes the ubiquitination and proteasomal degradation of target proteins. The protein encoded by this gene is thought to regulate RNA polymerase II-catalyzed transcription. Substrates for this protein's E3 ubiquitin ligase activity include the capsid protein of the West Nile virus and the catalytic subunit of the telomerase ribonucleoprotein. This protein controls cell cycle arrest and apoptosis by regulating p21, a cell cycle regulator, and the tumor suppressor protein p53. Pseudogenes of this gene are present on chromosomes 1, 3, 9, 12 and 20, and on the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]
Locus ID 23608
MW 17.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...