PARP9 (NM_031458) Human 3' UTR Clone

CAT#: SC206321

3' UTR clone of poly (ADP-ribose) polymerase family member 9 (PARP9) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name PARP9 (NM_031458) Human 3' UTR Clone
Vector pMirTarget
Synonyms ARTD9; BAL; BAL1; MGC:7868
ACCN NM_031458
Insert Size 470 bp
Sequence Data
>SC206321 3’UTR clone of NM_031458
The sequence shown below is from the reference sequence of NM_031458. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGATTCGCAAGTGGCAGCCCTGTTGATTAATCTCTACATCATTTTAACAGCTGGTATGGCCTTACCTTG
GGTGAACTAACCAAATAATGACCATCGATGGCTCAAAGAGTGGCTTGAATATATCCCATGGGTTATCTG
TATGGACTGACTGGGTTATTGAAAGGACTAGCCACATACTAGCATCTTAGTGCCTTTATCTGTCTTTAT
GTCTTGGGGTTGGGGTAGGTAGATACCAAATGAAACACTTTCAGGACCTTCCTTCCTCTTGCAGTTGTT
CTTTAATCTCCTTTACTAGAGGAGATAAATATTTTGCATATAATGAAGAAATTTTTCTAGTATATAACG
CAGGCCTTTTATTTTCTAAAATGATGATAGTATAAAAATGTTAGGATAACAGAATGATTTTAGATTTTC
CAGAGAATATTATAAAGTGCTTTAGGTATGAAAATAAATCATCTTTGTCTGATTAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_031458.3
Synonyms ARTD9; BAL; BAL1; MGC:7868
Summary ADP-ribosyltransferase which, in association with E3 ligase DTX3L, plays a role in DNA damage repair and in immune responses including interferon-mediated antiviral defenses (PubMed:16809771, PubMed:23230272, PubMed:26479788, PubMed:27796300). Within the complex, enhances DTX3L E3 ligase activity which is further enhanced by PARP9 binding to poly(ADP-ribose) (PubMed:28525742). In association with DTX3L and in presence of E1 and E2 enzymes, mediates NAD(+)-dependent mono-ADP-ribosylation of ubiquitin which prevents ubiquitin conjugation to substrates such as histones (PubMed:28525742). During DNA repair, PARP1 recruits PARP9/BAL1-DTX3L complex to DNA damage sites via PARP9 binding to ribosylated PARP1 (PubMed:23230272). Subsequent PARP1-dependent PARP9/BAL1-DTX3L-mediated ubiquitination promotes the rapid and specific recruitment of 53BP1/TP53BP1, UIMC1/RAP80, and BRCA1 to DNA damage sites (PubMed:23230272, PubMed:28525742). In response to DNA damage, PARP9-DTX3L complex is required for efficient non-homologous end joining (NHEJ); the complex function is negatively modulated by PARP9 activity (PubMed:28525742). Dispensable for B-cell receptor (BCR) assembly through V(D)J recombination and class switch recombination (CSR) (By similarity). In macrophages, positively regulates pro-inflammatory cytokines production in response to IFNG stimulation by suppressing PARP14-mediated STAT1 ADP-ribosylation and thus promoting STAT1 phosphorylation (PubMed:27796300). Also suppresses PARP14-mediated STAT6 ADP-ribosylation (PubMed:27796300).[UniProtKB/Swiss-Prot Function]
Locus ID 83666
MW 17.8
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...