CD42b (GP1BA) (NM_000173) Human 3' UTR Clone

CAT#: SC206307

3' UTR clone of glycoprotein Ib (platelet) alpha polypeptide (GP1BA) for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name CD42b (GP1BA) (NM_000173) Human 3' UTR Clone
Vector pMirTarget
Synonyms BDPLT1; BDPLT3; BSS; CD42B; CD42b-alpha; DBPLT3; GP1B; GPIbA; GPIbalpha; VWDP
ACCN NM_000173
Insert Size 490 bp
Sequence Data
>SC206307 3’UTR clone of NM_000173
The sequence shown below is from the reference sequence of NM_000173. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGCATTAGGTACTCTGGCCACAGCCTCTGAGGGTGGGAGGTTTGGGGACCTTGAGAGAAGAGCCTGTGG
GCTCTCCTATTGGAATCTAGTTGGGGGTTGGAGGGGTAAGGAACACAGGGTGATAGGGAGGGGTCTTAG
TTCCTTTTTCTGTATCAGAAGCCCTGTCTTCACAACACAGGCACACAATTTCAGTCCCAGCCAAAGCAG
AAGGGGTAATGACATGGACTTGGCGGGGGGACAAGACAAAGCTCCCGATGCTGCATGGGGCGCTGCCAG
ATCTCACGGTGAACCATTTTGGCAGAATACAGCATGGTTCCCACATGCATCTATGCACAGAAGAAAATC
TGGAAAGTGATTTATCAGGATGTGAGCACTCGTTGTGTCTGGATGTTACAAATATGGGTGGTTTTATTT
TCTTTTTCCCTGTTTAGCATTTTCTAGTTTTCCACTATTATTGTATATTATCTGTATAATAAAAAATAA
TTTTAGG
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_000173.7
Synonyms BDPLT1; BDPLT3; BSS; CD42B; CD42b-alpha; DBPLT3; GP1B; GPIbA; GPIbalpha; VWDP
Summary Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy. [provided by RefSeq, Oct 2013]
Locus ID 2811
MW 18.7
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...