FE65 (APBB1) (NM_001164) Human 3' UTR Clone

CAT#: SC205660

3' UTR clone of amyloid beta (A4) precursor protein-binding family B member 1 (Fe65) (APBB1) transcript variant 1 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FE65 (APBB1) (NM_001164) Human 3' UTR Clone
Vector pMirTarget
Synonyms FE65; MGC:9072; RIR
ACCN NM_001164
Insert Size 439 bp
Sequence Data
>SC205660 3’UTR clone of NM_001164
The sequence shown below is from the reference sequence of NM_001164. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
CCCAAACGGCTGGGGGCCCATACCCCATGAAGAAGCCCCCACCTTCCCTCCACCTGCTTGTGTTGGGCC
CCAGGGAACTAAAGGGTGTGGGTCAGGGAGGGGTCTAGAGGCTATTCCTAGGCCTCAGGCCTCCCAAAT
ATGCCCCTCCCCAGTAGCTACGGTTCCCTGCCTAGGAGCTGGGGAGGGAGAGATCTAATCCCTTCAAGG
AAGTGATAACACTGGAGTGGTAACAAGAGGAGCAGGAAGCAAGGCCAGCCCTGGTTCTCCATCCCCATG
TGTTTCAGGTGGAACAGGAGGAACTGGTCCAGGCCAGGCCTCATCCTCCTGGACCCAGCAGGGGCAGAA
GGAGGAAGGGACTGGTCCAGGCATGGGTCCCTTCCCCCTGCTCCATGGGCACCTCTGCTGTATTGATAT
CACTAATAAAGTCTGTCTGCACTGC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001164.5
Synonyms FE65; MGC:9072; RIR
Summary The protein encoded by this gene is a member of the Fe65 protein family. It is an adaptor protein localized in the nucleus. It interacts with the Alzheimer's disease amyloid precursor protein (APP), transcription factor CP2/LSF/LBP1 and the low-density lipoprotein receptor-related protein. APP functions as a cytosolic anchoring site that can prevent the gene product's nuclear translocation. This encoded protein could play an important role in the pathogenesis of Alzheimer's disease. It is thought to regulate transcription. Also it is observed to block cell cycle progression by downregulating thymidylate synthase expression. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
Locus ID 322
MW 16.5
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...