IL5RA (NM_175724) Human 3' UTR Clone

CAT#: SC205451

3' UTR clone of interleukin 5 receptor alpha (IL5RA) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name IL5RA (NM_175724) Human 3' UTR Clone
Vector pMirTarget
Synonyms CD125; CDw125; HSIL5R3; IL5R
ACCN NM_175724
Insert Size 420 bp
Sequence Data
>SC205451 3' UTR clone of NM_175724
The sequence shown below is from the reference sequence of NM_175724. The complete sequence of this clone may contain minor differences, such as SNPs. Red=Cloning site Blue=Stop Codon


CAATTGGCAGAGCTCAGAATTCAAGCGATCGC

AGTGAGTGGAGCCAACCTATTTATGTGGGTAAGTAGCTTATGTTTATTTTACATTGGCAGCCTTCCTTGT
GATCAAAAAAGGTAATCCCAGAAACGTACCCGTTCACTCGTGGGTCTTAAAATGGTTTCATATCTCTATT
GTGACTAATTTTCTCTCGGTCTACTGCCTTTTCAATCAGGAATAGATTTGCCATGAAGCCAGTGAAGTTT
TTAAGTGTCTAGGCTTCTCATTAGCGCCAACTCTCCTAGACCTGGTGCCTGTTTTTTTTCCAAGTTTTGT
TTCTACTTCTATCCATTTTTTAAATTAAACTTTTTATTTTGAAATAATTATCACACTCACAAGCTGTGGG
AAGAAATAATAGAGATCCTGTGTCTCTTTCATCCAGTTTTCCTCAAGGGTAACATCTTACAAAACTATAG

ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_175724.2
Synonyms CD125; CDw125; HSIL5R3; IL5R
Summary The protein encoded by this gene is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Several alternatively spliced transcript variants encoding four distinct isoforms have been reported. [provided by RefSeq, Jul 2011]
Locus ID 3568
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...