Chk1 (CHEK1) (NM_001114121) Human 3' UTR Clone

CAT#: SC205407

3' UTR clone of CHK1 checkpoint homolog (S. pombe) (CHEK1) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name Chk1 (CHEK1) (NM_001114121) Human 3' UTR Clone
Vector pMirTarget
Synonyms CHK1
ACCN NM_001114121
Insert Size 401 bp
Sequence Data
>SC205407 3’UTR clone of NM_001114121
The sequence shown below is from the reference sequence of NM_001114121. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
AGCCAGAAGATTTGGCTTCCTGCCACATGATCGGACCATCGGCTCTGGGGAATCCTGATGGAGTTTCAC
TCTTGTCTCCCAGGCTGGAGTACAATGGCATGATCTCAGCTTACTGCAACCTCCGTCTCCTGGGTTCAA
GCGATTCTCCTGCCTCAGCCTTCCAAGTAGCTGGGATTACAGGTGCCCACCACCACACCTGGCTAGGTT
TTGTATTTTTAGTAGAGATGGGGTTTTTTCATGTTGGCCAGGCTGATCTGGAACTCCTGACCTCAAGTG
ATCCACCTGCCTTGGCCTCCCAAAGTGCTGGGATTTTAGGTGTGAGCCACCTCGCCTGGCAAGGGATTC
TGTTCTTAGTCCTTGAAAAAATAAAGTTCTGAATCTTCAAAAAAAAAAAAAAAAAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001114121.2
Synonyms CHK1
Summary The protein encoded by this gene belongs to the Ser/Thr protein kinase family. It is required for checkpoint mediated cell cycle arrest in response to DNA damage or the presence of unreplicated DNA. This protein acts to integrate signals from ATM and ATR, two cell cycle proteins involved in DNA damage responses, that also associate with chromatin in meiotic prophase I. Phosphorylation of CDC25A protein phosphatase by this protein is required for cells to delay cell cycle progression in response to double-strand DNA breaks. Several alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2011]
Locus ID 1111
MW 14.9
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...