BAD (NM_032989) Human 3' UTR Clone

CAT#: SC205332

3' UTR clone of BCL2-associated agonist of cell death (BAD) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name BAD (NM_032989) Human 3' UTR Clone
Vector pMirTarget
Synonyms BBC2; BCL2L8
ACCN NM_032989
Insert Size 409 bp
Sequence Data
>SC205332 3’UTR clone of NM_032989
The sequence shown below is from the reference sequence of NM_032989. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
GGCAGGGGAAGCTCCGCCCCCTCCCAGTGACCTTCGCTCCACATCCCGAAACTCCACCCGTTCCCACTG
CCCTGGGCAGCCATCTTGAATATGGGCGGAAGTACTTCCCTCAGGCCTATGCAAAAAGAGGATCCGTGC
TGTCTCCTTTGGAGGGAGGGCTGACCCAGATTCCCTTCCGGTGCGTGTGAAGCCACGGAAGGCTTGGTC
CCATCGGAAGTTTTGGGTTTTCCGCCCACAGCCGCCGGAAGTGGCTCCGTGGCCCCGCCCTCAGGCTCC
GGGCTTTCCCCCAGGCGCCTGCGCTAAGTCGCGAGCCAGGTTTAACCGTTGCGTCACCGGGACCCGAGC
CCCCGCGATGCCCTGGGGGCCGTGCTCACTACCAAATGTTAATAAAGCCCGCGTCTGTGCCGCC
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_032989.3
Synonyms BBC2; BCL2L8
Summary The protein encoded by this gene is a member of the BCL-2 family. BCL-2 family members are known to be regulators of programmed cell death. This protein positively regulates cell apoptosis by forming heterodimers with BCL-xL (B-cell lymphoma-extra large) and BCL-2, and reversing their death repressor activity. Proapoptotic activity of this protein is regulated through its phosphorylation. Protein kinases AKT and MAP kinase, as well as protein phosphatase calcineurin were found to be involved in the regulation of this protein. Alternative splicing of this gene results in two transcript variants which encode the same isoform. [provided by RefSeq, Dec 2019]
Locus ID 572
MW 14.4
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...