FMO3 (NM_001002294) Human 3' UTR Clone

CAT#: SC205330

3' UTR clone of flavin containing monooxygenase 3 (FMO3) transcript variant 2 for miRNA target validation



Need custom modification / cloning service?
Get a free quote

CNY 4,845.00


货期*
3周

规格
    • 10 ug

Product images

经常一起买 (2)
Firefly luciferase assay kit, 150 assays
    • 1 kit

CNY 1,520.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00

Specifications

Product Data
Product Name FMO3 (NM_001002294) Human 3' UTR Clone
Vector pMirTarget
Synonyms dJ127D3.1; FMOII; TMAU
ACCN NM_001002294
Insert Size 407 bp
Sequence Data
>SC205330 3’UTR clone of NM_001002294
The sequence shown below is from the reference sequence of NM_001002294. The complete sequence of this clone may contain minor differences, such as SNPs.
Blue=Stop Codon Red=Cloning site

GGCAAGTTGGACGCCCGCAAGATCCGCGAGATTCTCATTAAGGCCAAGAAGGGCGGAAAGATCGCCGTG
TAACAATTGGCAGAGCTCAGAATTCAAGCGATCGCC
TTAATCGCTGTTTTCCTTGTGTTGACCTAATCATCATTTTCTCTAGGATTTCTGAAAGTTACTGACAAT
ACCCAGACAGGGGCTTTGCTATTTAAAAATTAAAATTTTCACACCACCTGCTTTTCTATTCAGCATCTT
TTGCAGTACTCTGTAGACATTAGTCAGTAATACAGTGTTATTTCTAGGCTCTGAAATAGCCACTTTAAG
AATCATGTCATGATCTTAAGAGAGCACTAATCATTTCTGTTTGAGTTCCACTAACACTTCAAAATCAGA
ACTATGTTCTTTATATCTAACTTAAATCATTTCCTGAAACATTTTGACATGATTCCTTTTTCCTTTTAA
ACAATGTATGAAAGATGTATTTTAAATCTAAATAAAGAGCAAATTAAGCAGAATAATTATAA
ACGCGTAAGCGGCCGCGGCATCTAGATTCGAAGAAAATGACCGACCAAGCGACGCCCAACCTGCCATCA
CGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGG
Restriction Sites SgfI-MluI     
OTI Disclaimer Our molecular clone sequence data has been matched to the sequence identifier above as a point of reference. Note that the complete sequence of this clone is largely the same as the reference sequence but may contain minor differences , e.g., single nucleotide polymorphisms (SNPs).
Reference Data
RefSeq NM_001002294.3
Synonyms dJ127D3.1; FMOII; TMAU
Summary Flavin-containing monooxygenases (FMO) are an important class of drug-metabolizing enzymes that catalyze the NADPH-dependent oxygenation of various nitrogen-,sulfur-, and phosphorous-containing xenobiotics such as therapeutic drugs, dietary compounds, pesticides, and other foreign compounds. The human FMO gene family is composed of 5 genes and multiple pseudogenes. FMO members have distinct developmental- and tissue-specific expression patterns. The expression of this FMO3 gene, the major FMO expressed in adult liver, can vary up to 20-fold between individuals. This inter-individual variation in FMO3 expression levels is likely to have significant effects on the rate at which xenobiotics are metabolised and, therefore, is of considerable interest to the pharmaceutical industry. This transmembrane protein localizes to the endoplasmic reticulum of many tissues. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. Mutations in this gene cause the disorder trimethylaminuria (TMAu) which is characterized by the accumulation and excretion of unmetabolized trimethylamine and a distinctive body odor. In healthy individuals, trimethylamine is primarily converted to the non odorous trimethylamine N-oxide.[provided by RefSeq, Jan 2016]
Locus ID 2328
MW 16.1
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Documents

Customer Reviews 
Loading...